Dissecting effectivity of a 5′ fast amplification of cDNA ends

Dissecting effectivity of a 5′ fast amplification of cDNA ends (5′-RACE) strategy for profiling T-cell receptor beta repertoire

• Deep sequencing of T-cell receptor (TCR) genes is highly effective at profiling immune repertoire. To organize a TCR sequencing library, multiplex polymerase chain response (mPCR) is broadly utilized and is extremely environment friendly.

 

• That’s, most mPCR merchandise include the area vital for antigen recognition, which additionally signifies common V(D)J recombination. Multiplex PCR, nonetheless, could endure from primer bias. A promising different is 5′-RACE, which avoids primer bias by making use of just one primer pair. In 5′-RACE information, nonetheless, non-regular V(D)J recombination (e.g., TCR sequences and not using a V gene section) has been noticed and the frequency varies (30-80%) between research.

 

• This implies that the reason for or find out how to scale back non-regular TCR sequences isn’t but well-known by the science neighborhood. Though it’s doable to take a position the trigger by evaluating the 5′-RACE protocols, cautious experimental affirmation is required and such a scientific examine continues to be not obtainable.

 

• Right here, we examined the 5′-RACE protocol of a industrial equipment and demonstrated how a modification elevated the fraction of normal TCR-β sequences to >85%. We additionally discovered a robust linear correlation between the fraction of quick DNA fragments and the proportion of non-regular TCR-β sequences, indicating that the presence of quick DNA fragments within the library was the primary reason behind non-regular TCR-β sequences.

 

• Subsequently, thorough elimination of quick DNA fragments from a 5′-RACE library is the important thing to excessive information effectivity. We extremely advocate conducting a fraction size evaluation earlier than sequencing, and the fraction of quick DNA fragments can be utilized to estimate the proportion of non-regular TCR sequences. As deep sequencing of TCR genes continues to be comparatively costly, good high quality management must be worthwhile.

NUDCD3 siRNA
20-abx926555	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pENTR223- NUDCD3
PVT11465	Lifescience Market	2 ug	EUR 273.00

anti-NUDCD3
YF-PA17860	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to NUDCD3

NUDCD3 Blocking Peptide
33R-4441	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUDCD3 antibody, catalog no. 70R-3285

NUDCD3 Conjugated Antibody
C42980	SAB	100ul	EUR 397.00

NUDCD3 cloning plasmid
CSB-CL811605HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 663 Sequence: atggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctgga Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 cloning plasmid
CSB-CL811605HU2-10ug	Cusabio	10ug	EUR 413.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1086 Sequence: atggagccaggggcggccgagctgtatgaccaggcccttttgggcatcctgcagcacgtgggcaacgtccaggatttcctgcgcgttctctttggcttcctctaccgcaagacagacttctatcgcttgctgcgccacccatcggaccgcatgggcttcccgcccggggccgcgc Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 Polyclonal Antibody
A60090	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NUDCD3 Rabbit pAb
A18436-100ul	Abclonal	100 ul	EUR 308.00

NUDCD3 Rabbit pAb
A18436-200ul	Abclonal	200 ul	EUR 459.00

NUDCD3 Rabbit pAb
A18436-20ul	Abclonal	20 ul	EUR 183.00

NUDCD3 Rabbit pAb
A18436-50ul	Abclonal	50 ul	EUR 223.00

anti- NUDCD3 antibody
FNab05897	FN Test	100µg	EUR 585.00
Immunogen: NudC domain containing 3 Uniprot ID: Q8IVD9 Gene ID: 23386 Research Area: Cell Division and Proliferation
Description: Antibody raised against NUDCD3

Anti-NUDCD3 antibody
PAab05897	Lifescience Market	100 ug	EUR 412.00

pCMV-SPORT6-NUDCD3
PVT12543	Lifescience Market	2 ug	EUR 391.00

Anti-NUDCD3 antibody
STJ11100390	St John's Laboratory	100 µl	EUR 277.00

NUDCD3 Antibody, HRP conjugated
1-CSB-PA811605LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, FITC conjugated
1-CSB-PA811605LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, Biotin conjugated
1-CSB-PA811605LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUDCD3 ELISA KIT|Human
EF001364	Lifescience Market	96 Tests	EUR 689.00

Human NUDCD3 shRNA Plasmid
20-abx958230	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse NUDCD3 shRNA Plasmid
20-abx980627	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

NUDCD3 Recombinant Protein (Human)
RP021817	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Human)
RP021820	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Mouse)
RP155360	ABM	100 ug	Ask for price

NUDCD3 Recombinant Protein (Rat)
RP214763	ABM	100 ug	Ask for price

NUDCD3 Polyclonal Antibody, Biotin Conjugated
A60091	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NUDCD3 Polyclonal Antibody, FITC Conjugated
A60092	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NUDCD3 Polyclonal Antibody, HRP Conjugated
A60093	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Nudcd3 ORF Vector (Rat) (pORF)
ORF071589	ABM	1.0 ug DNA	EUR 506.00

NUDCD3 ORF Vector (Human) (pORF)
ORF007273	ABM	1.0 ug DNA	EUR 95.00

NUDCD3 ORF Vector (Human) (pORF)
ORF007274	ABM	1.0 ug DNA	EUR 95.00

Nudcd3 ORF Vector (Mouse) (pORF)
ORF051788	ABM	1.0 ug DNA	EUR 506.00

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	0 1
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294.00

Evo? cDNA Kit
M1164-25	Biovision		EUR 234.00

Novo? cDNA Kit
M1165-100	Biovision		EUR 354.00

Novo? cDNA Kit
M1165-25	Biovision		EUR 267.00

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381.00

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267.00

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441.00

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289.00

NudC Domain Containing 3 (NUDCD3) Antibody
abx235897-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

NudC Domain Containing 3 (NUDCD3) Antibody
20-abx302663	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nudcd3 sgRNA CRISPR Lentivector set (Rat)
K7522401	ABM	3 x 1.0 ug	EUR 339.00

Nudcd3 sgRNA CRISPR Lentivector set (Mouse)
K4846501	ABM	3 x 1.0 ug	EUR 339.00

NUDCD3 sgRNA CRISPR Lentivector set (Human)
K1463701	ABM	3 x 1.0 ug	EUR 339.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	0 1
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	0 1
Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106.00

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169.00

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309.00

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445.00

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952.00

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441.00

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415.00

NudC Domain Containing 3 (NUDCD3) Antibody (HRP)
20-abx308546	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (FITC)
20-abx308547	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (Biotin)
20-abx308548	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7522402	ABM	1.0 ug DNA	EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7522403	ABM	1.0 ug DNA	EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7522404	ABM	1.0 ug DNA	EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4846502	ABM	1.0 ug DNA	EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4846503	ABM	1.0 ug DNA	EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4846504	ABM	1.0 ug DNA	EUR 154.00

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1463702	ABM	1.0 ug DNA	EUR 154.00

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1463703	ABM	1.0 ug DNA	EUR 154.00

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1463704	ABM	1.0 ug DNA	EUR 154.00

NUDCD3 Protein Vector (Rat) (pPB-C-His)
PV286354	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Rat) (pPB-N-His)
PV286355	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Rat) (pPM-C-HA)
PV286356	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Rat) (pPM-C-His)
PV286357	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPB-C-His)
PV207150	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPB-N-His)
PV207151	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPM-C-HA)
PV207152	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPM-C-His)
PV207153	ABM	500 ng	EUR 603.00

NUDCD3 Protein Vector (Human) (pPB-C-His)
PV029089	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-N-His)
PV029090	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-HA)
PV029091	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-His)
PV029092	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-C-His)
PV029093	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-N-His)
PV029094	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-HA)
PV029095	ABM	500 ng	EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-His)
PV029096	ABM	500 ng	EUR 329.00

Nudcd3 3'UTR Luciferase Stable Cell Line
TU114400	ABM	1.0 ml	Ask for price

Nudcd3 3'UTR GFP Stable Cell Line
TU164400	ABM	1.0 ml	Ask for price

Nudcd3 3'UTR Luciferase Stable Cell Line
TU214265	ABM	1.0 ml	Ask for price

Nudcd3 3'UTR GFP Stable Cell Line
TU264265	ABM	1.0 ml	Ask for price

NUDCD3 3'UTR GFP Stable Cell Line
TU066058	ABM	1.0 ml	EUR 2333.00

NUDCD3 3'UTR Luciferase Stable Cell Line
TU016058	ABM	1.0 ml	EUR 2333.00

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	0 1
Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

 

Analysis notice: Massive gene household of phosphoenolpyruvate carboxylase within the crassulacean acid metabolism plant Kalanchoepinnata (Crassulaceae) characterised by partial cDNA sequence evaluation

Clones coding for a 1100-bp cDNA sequence of phosphoenolpyruvate carboxylase (PEPC) of the constitutive crassulacean acid metabolism (CAM) plant Kalanchoepinnata (Lam.) Pers., have been remoted by reverse transcription-polymerase chain response (RT-PCR) and characterised by restriction fragment size polymorphism evaluation and DNA sequencing.

 

Seven distinct PEPC isogenes have been recovered, 4 in leaves and three in roots (EMBL accession numbers: AJ344052-AJ344058). Sequence similarity comparisons and distance neighbour-joining calculations separate the seven PEPC isoforms into two clades, one in every of which comprises the three PEPCs present in roots. The second clade comprises the 4 isoforms present in leaves and is split into two branches, one in every of which comprises two PEPCs most related with described beforehand CAM isoforms.

 

Of those two isoforms, nonetheless, just one exhibited considerable expression in CAM-performing leaves, however not in very younger leaves, which don’t exhibit CAM, suggesting this isoform encodes a CAM-specific PEPC. Protein sequence calculations counsel that every one isogenes are seemingly derived from a standard ancestor gene, presumably by serial gene duplication occasions. To our data, that is essentially the most complete identification of a PEPC gene household from a CAM plant, and the best variety of PEPC isogenes reported for any vascular plant up to now.

 

 

Molecular evaluation of a stress-induced cDNA encoding the interpretation initiation issue, eIF1, from the salt-tolerant wild relative of rice, Porteresiacoarctata

The evaluation of plant response to emphasize is a crucial path to the invention of genes conferring stress tolerance. Protein synthesis is very delicate to salt stress and proteins concerned on this course of could also be an vital determinant of salt tolerance.

 

The halophytic plant, PorteresiacoarctataTateoka, is an in depth relative of Oryzasativa L., and has the power to face up to sudden adjustments within the soil salinity. The interpretation initiation issue 1 (PceIF1) cDNA was remoted from the leaves of P. coarctata that had been subjected to a high-salt therapy (150 mm NaCl). An expression examine confirmed that the abundance of eIF1 transcripts elevated to a most degree 5 d after stress induction after which decreased to ranges much like leaves of management (unsalinised) crops.

 

This gene was additionally up-regulated in exogenous abscisic acid (ABA) and mannitol therapies, suggesting that its induction is expounded to the water deficit impact of excessive salt. Our research confirmed that expression ranges of eIF1 transcripts would possibly kind a handy indicator for monitoring a stress-responsive mechanism that operates within the leaves of P. coarctata.

Search for viral agents in cerebrospinal fluid in patients with multiple sclerosis using real-time PCR and metagenomics

 

WDR78 cloning plasmid
CSB-CL719620HU2-10ug	Cusabio	10ug	EUR 822.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2547 Sequence: atgacgcccggcaaacattccggagcctcggcccgagccgctaacgcaggagcttgggggtacagggacttcagaggcggccaaaaaaaggggtggtggaccactccccagctggtcgccaccatgccagtctctccggcaggcagtcacaagcagcagaacttcgggttgaaca Show more
Description: A cloning plasmid for the WDR78 gene.

Rat WDR78 shRNA Plasmid
20-abx989767	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse WDR78 shRNA Plasmid
20-abx982585	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human WDR78 shRNA Plasmid
20-abx962588	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Wdr78 ORF Vector (Mouse) (pORF)
ORF061805	ABM	1.0 ug DNA	EUR 506.00

Wdr78 ORF Vector (Rat) (pORF)
ORF079111	ABM	1.0 ug DNA	EUR 506.00

WDR78 ORF Vector (Human) (pORF)
ORF014948	ABM	1.0 ug DNA	EUR 354.00

WDR78 ORF Vector (Human) (pORF)
ORF011578	ABM	1.0 ug DNA	EUR 95.00

Wdr78 sgRNA CRISPR Lentivector set (Rat)
K6359901	ABM	3 x 1.0 ug	EUR 339.00

WDR78 sgRNA CRISPR Lentivector set (Human)
K2635401	ABM	3 x 1.0 ug	EUR 339.00

Wdr78 sgRNA CRISPR Lentivector set (Mouse)
K4526301	ABM	3 x 1.0 ug	EUR 339.00

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	0 1
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294.00

Evo? cDNA Kit
M1164-25	Biovision		EUR 234.00

Novo? cDNA Kit
M1165-100	Biovision		EUR 354.00

Novo? cDNA Kit
M1165-25	Biovision		EUR 267.00

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381.00

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267.00

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441.00

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

WD Repeat-Containing Protein 78 (WDR78) Antibody
abx037278-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6359902	ABM	1.0 ug DNA	EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6359903	ABM	1.0 ug DNA	EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6359904	ABM	1.0 ug DNA	EUR 154.00

WDR78 sgRNA CRISPR Lentivector (Human) (Target 1)
K2635402	ABM	1.0 ug DNA	EUR 154.00

WDR78 sgRNA CRISPR Lentivector (Human) (Target 2)
K2635403	ABM	1.0 ug DNA	EUR 154.00

WDR78 sgRNA CRISPR Lentivector (Human) (Target 3)
K2635404	ABM	1.0 ug DNA	EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4526302	ABM	1.0 ug DNA	EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4526303	ABM	1.0 ug DNA	EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4526304	ABM	1.0 ug DNA	EUR 154.00

WDR78 Protein Vector (Mouse) (pPB-C-His)
PV247218	ABM	500 ng	EUR 1065.00

WDR78 Protein Vector (Mouse) (pPB-N-His)
PV247219	ABM	500 ng	EUR 1065.00

WDR78 Protein Vector (Mouse) (pPM-C-HA)
PV247220	ABM	500 ng	EUR 1065.00

WDR78 Protein Vector (Mouse) (pPM-C-His)
PV247221	ABM	500 ng	EUR 1065.00

WDR78 Protein Vector (Rat) (pPB-C-His)
PV316442	ABM	500 ng	EUR 1166.00

WDR78 Protein Vector (Rat) (pPB-N-His)
PV316443	ABM	500 ng	EUR 1166.00

WDR78 Protein Vector (Rat) (pPM-C-HA)
PV316444	ABM	500 ng	EUR 1166.00

WDR78 Protein Vector (Rat) (pPM-C-His)
PV316445	ABM	500 ng	EUR 1166.00

WDR78 Protein Vector (Human) (pPB-C-His)
PV059789	ABM	500 ng	EUR 481.00

WDR78 Protein Vector (Human) (pPB-N-His)
PV059790	ABM	500 ng	EUR 481.00

WDR78 Protein Vector (Human) (pPM-C-HA)
PV059791	ABM	500 ng	EUR 481.00

WDR78 Protein Vector (Human) (pPM-C-His)
PV059792	ABM	500 ng	EUR 481.00

WDR78 Protein Vector (Human) (pPB-C-His)
PV046309	ABM	500 ng	EUR 329.00

WDR78 Protein Vector (Human) (pPB-N-His)
PV046310	ABM	500 ng	EUR 329.00

WDR78 Protein Vector (Human) (pPM-C-HA)
PV046311	ABM	500 ng	EUR 329.00

WDR78 Protein Vector (Human) (pPM-C-His)
PV046312	ABM	500 ng	EUR 329.00

Wdr78 3'UTR Luciferase Stable Cell Line
TU122263	ABM	1.0 ml	Ask for price

WDR78 3'UTR GFP Stable Cell Line
TU078449	ABM	1.0 ml	EUR 1394.00

Wdr78 3'UTR GFP Stable Cell Line
TU172263	ABM	1.0 ml	Ask for price

Wdr78 3'UTR Luciferase Stable Cell Line
TU223372	ABM	1.0 ml	Ask for price

WDR78 3'UTR Luciferase Stable Cell Line
TU028449	ABM	1.0 ml	EUR 1394.00

Wdr78 3'UTR GFP Stable Cell Line
TU273372	ABM	1.0 ml	Ask for price

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	0 1
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	0 1
Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106.00

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169.00

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309.00

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445.00

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952.00

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441.00

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415.00

WDR78 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702027	ABM	1.0 ug DNA	EUR 450.00

WDR78 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702031	ABM	1.0 ug DNA	EUR 450.00

WDR78 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702032	ABM	1.0 ug DNA	EUR 450.00

WDR78 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV664135	ABM	1.0 ug DNA	EUR 1355.00

WDR78 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV664139	ABM	1.0 ug DNA	EUR 1355.00

WDR78 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV664140	ABM	1.0 ug DNA	EUR 1355.00

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	0 1
Shipped within 5-10 working days.

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart
C1236122Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum
C1236130Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney
C1236142Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver
C1236149Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung
C1236152Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung
C1236152Ld-5	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm
C1236169Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas
C1236188Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin
C1236218Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine
C1236226Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord
C1236234Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen
C1236246Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA
HT05-090	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Lung
HA-152	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Skin
HA-218	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Testis
HA-260	Alpha Diagnostics	10 rxn	EUR 415.00

Total-Transcriptome cDNA Synthesis Kit
G904	ABM	25 reactions	EUR 224.00

Total-Transcriptome cDNA Synthesis Kit
G905	ABM	100 reactions	EUR 544.00

Mouse iNOS (macrophage) cDNA probe
iNOS61-D-2	Alpha Diagnostics	2 ug	EUR 445.00

Evo? cDNA Kit (gDNA Removal)
M1166-100	Biovision		EUR 381.00

Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265	Alpha Diagnostics	10 rxn	EUR 415.00

Accuris qMax cDNA Synthesis Kit
PR2100-C-100	BenchMark	1 PC	EUR 337.75
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-25	BenchMark	1 PC	EUR 142.36
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-250	BenchMark	1 PC	EUR 711.77
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-S	BenchMark	1 PC	EUR 77.76
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix
R5101-050	GenDepot	50 rxns	EUR 415.00

amfiRivert cDNA Synthesis Master Mix
R5101-100	GenDepot	2X50 rxns	EUR 847.00

amfiRivert cDNA Synthesis Master Mix
R5101-200	GenDepot	4X50 rxns	EUR 1211.00

amfiRivet cDNA Synthesis 2X Buffer
R5102-050	GenDepot	500ul	EUR 134.00

amfiRivet cDNA Synthesis 2X Buffer
R5102-100	GenDepot	2x500ul	EUR 192.00

Human WD repeat- containing protein 78, WDR78 ELISA KIT
ELI-28748h	Lifescience Market	96 Tests	EUR 824.00

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]
CD510VB-1	SBI	>1 x 10^6 IFUs	EUR 786.00
Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix
B24403	Bimake	200 ractions	EUR 456.00
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix
B24408	Bimake	1000 ractions	EUR 1453.00
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions
AZ-1995	Real Time Primers	25 Reactions	EUR 153.00

AzuraQuant cDNA Synthesis Kit - 100 Reactions
AZ-1996	Real Time Primers	100 Reactions	EUR 372.00

miRNA First-Strand cDNA Synthesis SuperMix
abx098020-20rxns20ulSystems	Abbexa	20 rxns × 20 ul Systems	EUR 732.00
Shipped within 5-10 working days.

Fly First-Strand cDNA Synthesis SuperMix
20-abx09885820ulSystems	Abbexa	EUR 718.00 EUR 578.00	0 1
Shipped within 5-10 working days.

cDNA from Human Tumor Tissue: Adrenal
C1235004-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder
C1235010-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone
C1235023-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain
C1235035-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast
C1235086	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon
C1235090	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney
C1235142	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Liver
C1235149	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lung
C1235152	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lymphoma
C1235161-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Mesenchymoma
C1235164-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Nose
C1235178-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Ovary
C1235183-10	Biochain	10 reactions	EUR 494.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Pancreas
C1235188-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Parathyroid
C1235189-10	Biochain	10 reactions	EUR 494.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Prostate
C1235201-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Rectum
C1235206-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Skin
C1235218-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Melanoma
C1235218A-10	Biochain	10 reactions	EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Stomach
C1235248	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Uterus
C1235274	Biochain	40 reactions	EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Brain
C1236035Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Multiple Sclerosis Disease: Brain
C1236035Msc	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Amygdala
C1236036Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Cerebellum
C1236039Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Hippocampus
C1236052Alz	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain: Hippocampus
C1236052Par	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Pons
C1236071Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Thalamus
C1236079Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Colon
C1236090Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Esophagus
C1236106Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Heart
C1236122Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congenital heart disease: Heart
C1236122Hd-3	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Coronary Artery Atherosclerosis: Heart
C1236122Hd-5	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congestive Heart Failure: Heart
C1236122Hd-6	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, left
C1236126Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, right
C1236127Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, left
C1236138Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, right
C1236139Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Kidney
C1236142Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Liver
C1236149Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Left Lobe
C1236150Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Right Lobe
C1236151Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Lung
C1236152Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lymph Node
C1236161Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Pancreas
C1236188Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Skin
C1236218Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Small Intestine
C1236226Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spinal Cord
C1236234Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Spleen
C1236246Dia	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.