Dissecting effectivity of a 5′ fast amplification of cDNA ends


Dissecting effectivity of a 5′ fast amplification of cDNA ends (5′-RACE) strategy for profiling T-cell receptor beta repertoire

  • Deep sequencing of T-cell receptor (TCR) genes is highly effective at profiling immune repertoire. To organize a TCR sequencing library, multiplex polymerase chain response (mPCR) is broadly utilized and is extremely environment friendly.


  • That’s, most mPCR merchandise include the area vital for antigen recognition, which additionally signifies common V(D)J recombination. Multiplex PCR, nonetheless, could endure from primer bias. A promising different is 5′-RACE, which avoids primer bias by making use of just one primer pair. In 5′-RACE information, nonetheless, non-regular V(D)J recombination (e.g., TCR sequences and not using a V gene section) has been noticed and the frequency varies (30-80%) between research.


  • This implies that the reason for or find out how to scale back non-regular TCR sequences isn’t but well-known by the science neighborhood. Though it’s doable to take a position the trigger by evaluating the 5′-RACE protocols, cautious experimental affirmation is required and such a scientific examine continues to be not obtainable.


  • Right here, we examined the 5′-RACE protocol of a industrial equipment and demonstrated how a modification elevated the fraction of normal TCR-β sequences to >85%. We additionally discovered a robust linear correlation between the fraction of quick DNA fragments and the proportion of non-regular TCR-β sequences, indicating that the presence of quick DNA fragments within the library was the primary reason behind non-regular TCR-β sequences.


  • Subsequently, thorough elimination of quick DNA fragments from a 5′-RACE library is the important thing to excessive information effectivity. We extremely advocate conducting a fraction size evaluation earlier than sequencing, and the fraction of quick DNA fragments can be utilized to estimate the proportion of non-regular TCR sequences. As deep sequencing of TCR genes continues to be comparatively costly, good high quality management must be worthwhile.


NUDCD3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000


PVT11465 2 ug
EUR 273.00


YF-PA17860 50 ug
EUR 363.00
Description: Mouse polyclonal to NUDCD3

NUDCD3 Conjugated Antibody

C42980 100ul
EUR 397.00

anti- NUDCD3 antibody

FNab05897 100µg
EUR 585.00
  • Immunogen: NudC domain containing 3
  • Uniprot ID: Q8IVD9
  • Gene ID: 23386
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against NUDCD3

NUDCD3 Polyclonal Antibody

A60090 100 µg
EUR 570.55
Description: reagents widely cited

NUDCD3 Rabbit pAb

A18436-100ul 100 ul
EUR 308.00

NUDCD3 Rabbit pAb

A18436-200ul 200 ul
EUR 459.00

NUDCD3 Rabbit pAb

A18436-20ul 20 ul
EUR 183.00

NUDCD3 Rabbit pAb

A18436-50ul 50 ul
EUR 223.00

NUDCD3 Blocking Peptide

33R-4441 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUDCD3 antibody, catalog no. 70R-3285

NUDCD3 cloning plasmid

CSB-CL811605HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 663
  • Sequence: atggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctgga
  • Show more
Description: A cloning plasmid for the NUDCD3 gene.

NUDCD3 cloning plasmid

CSB-CL811605HU2-10ug 10ug
EUR 413.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggagccaggggcggccgagctgtatgaccaggcccttttgggcatcctgcagcacgtgggcaacgtccaggatttcctgcgcgttctctttggcttcctctaccgcaagacagacttctatcgcttgctgcgccacccatcggaccgcatgggcttcccgcccggggccgcgc
  • Show more
Description: A cloning plasmid for the NUDCD3 gene.

Anti-NUDCD3 antibody

PAab05897 100 ug
EUR 412.00


PVT12543 2 ug
EUR 391.00

Anti-NUDCD3 antibody

STJ11100390 100 µl
EUR 277.00

Mouse NUDCD3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF001364 96 Tests
EUR 689.00

Human NUDCD3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NUDCD3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUDCD3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUDCD3. Recognizes NUDCD3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUDCD3 Recombinant Protein (Human)

RP021817 100 ug Ask for price

NUDCD3 Recombinant Protein (Human)

RP021820 100 ug Ask for price

NUDCD3 Recombinant Protein (Rat)

RP214763 100 ug Ask for price

NUDCD3 Recombinant Protein (Mouse)

RP155360 100 ug Ask for price

NUDCD3 Polyclonal Antibody, Biotin Conjugated

A60091 100 µg
EUR 570.55
Description: Ask the seller for details

NUDCD3 Polyclonal Antibody, FITC Conjugated

A60092 100 µg
EUR 570.55
Description: The best epigenetics products

NUDCD3 Polyclonal Antibody, HRP Conjugated

A60093 100 µg
EUR 570.55
Description: kits suitable for this type of research

NUDCD3 ORF Vector (Human) (pORF)

ORF007273 1.0 ug DNA
EUR 95.00

NUDCD3 ORF Vector (Human) (pORF)

ORF007274 1.0 ug DNA
EUR 95.00

Nudcd3 ORF Vector (Rat) (pORF)

ORF071589 1.0 ug DNA
EUR 506.00

Nudcd3 ORF Vector (Mouse) (pORF)

ORF051788 1.0 ug DNA
EUR 506.00

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294.00

Evo? cDNA Kit

EUR 234.00

Novo? cDNA Kit

EUR 354.00

Novo? cDNA Kit

EUR 267.00

Evo? cDNA Supermix

EUR 381.00

Evo? cDNA Supermix

EUR 267.00

Novo? cDNA Supermix

EUR 441.00

Novo? cDNA Supermix

EUR 289.00

NudC Domain Containing 3 (NUDCD3) Antibody

abx235897-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

NudC Domain Containing 3 (NUDCD3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NUDCD3 sgRNA CRISPR Lentivector set (Human)

K1463701 3 x 1.0 ug
EUR 339.00

Nudcd3 sgRNA CRISPR Lentivector set (Mouse)

K4846501 3 x 1.0 ug
EUR 339.00

Nudcd3 sgRNA CRISPR Lentivector set (Rat)

K7522401 3 x 1.0 ug
EUR 339.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106.00

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169.00

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309.00

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445.00

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415.00

Novo? Transcriptome cDNA Kit

EUR 952.00

Novo? Transcriptome cDNA Kit

EUR 441.00

NudC Domain Containing 3 (NUDCD3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NudC Domain Containing 3 (NUDCD3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1463702 1.0 ug DNA
EUR 154.00

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1463703 1.0 ug DNA
EUR 154.00

NUDCD3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1463704 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4846502 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4846503 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4846504 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7522402 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7522403 1.0 ug DNA
EUR 154.00

Nudcd3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7522404 1.0 ug DNA
EUR 154.00

NUDCD3 Protein Vector (Human) (pPB-C-His)

PV029089 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-N-His)

PV029090 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-HA)

PV029091 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-His)

PV029092 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-C-His)

PV029093 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPB-N-His)

PV029094 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-HA)

PV029095 500 ng
EUR 329.00

NUDCD3 Protein Vector (Human) (pPM-C-His)

PV029096 500 ng
EUR 329.00

NUDCD3 Protein Vector (Mouse) (pPB-C-His)

PV207150 500 ng
EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPB-N-His)

PV207151 500 ng
EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPM-C-HA)

PV207152 500 ng
EUR 603.00

NUDCD3 Protein Vector (Mouse) (pPM-C-His)

PV207153 500 ng
EUR 603.00

NUDCD3 Protein Vector (Rat) (pPB-C-His)

PV286354 500 ng
EUR 603.00

NUDCD3 Protein Vector (Rat) (pPB-N-His)

PV286355 500 ng
EUR 603.00

NUDCD3 Protein Vector (Rat) (pPM-C-HA)

PV286356 500 ng
EUR 603.00

NUDCD3 Protein Vector (Rat) (pPM-C-His)

PV286357 500 ng
EUR 603.00

Nudcd3 3'UTR GFP Stable Cell Line

TU164400 1.0 ml Ask for price

NUDCD3 3'UTR Luciferase Stable Cell Line

TU016058 1.0 ml
EUR 2333.00

Nudcd3 3'UTR Luciferase Stable Cell Line

TU114400 1.0 ml Ask for price

NUDCD3 3'UTR GFP Stable Cell Line

TU066058 1.0 ml
EUR 2333.00

Nudcd3 3'UTR GFP Stable Cell Line

TU264265 1.0 ml Ask for price

Nudcd3 3'UTR Luciferase Stable Cell Line

TU214265 1.0 ml Ask for price

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.


Analysis notice: Massive gene household of phosphoenolpyruvate carboxylase within the crassulacean acid metabolism plant Kalanchoepinnata (Crassulaceae) characterised by partial cDNA sequence evaluation

Clones coding for a 1100-bp cDNA sequence of phosphoenolpyruvate carboxylase (PEPC) of the constitutive crassulacean acid metabolism (CAM) plant Kalanchoepinnata (Lam.) Pers., have been remoted by reverse transcription-polymerase chain response (RT-PCR) and characterised by restriction fragment size polymorphism evaluation and DNA sequencing.


Seven distinct PEPC isogenes have been recovered, 4 in leaves and three in roots (EMBL accession numbers: AJ344052-AJ344058). Sequence similarity comparisons and distance neighbour-joining calculations separate the seven PEPC isoforms into two clades, one in every of which comprises the three PEPCs present in roots. The second clade comprises the 4 isoforms present in leaves and is split into two branches, one in every of which comprises two PEPCs most related with described beforehand CAM isoforms.


Of those two isoforms, nonetheless, just one exhibited considerable expression in CAM-performing leaves, however not in very younger leaves, which don’t exhibit CAM, suggesting this isoform encodes a CAM-specific PEPC. Protein sequence calculations counsel that every one isogenes are seemingly derived from a standard ancestor gene, presumably by serial gene duplication occasions. To our data, that is essentially the most complete identification of a PEPC gene household from a CAM plant, and the best variety of PEPC isogenes reported for any vascular plant up to now.



Molecular evaluation of a stress-induced cDNA encoding the interpretation initiation issue, eIF1, from the salt-tolerant wild relative of rice, Porteresiacoarctata

The evaluation of plant response to emphasize is a crucial path to the invention of genes conferring stress tolerance. Protein synthesis is very delicate to salt stress and proteins concerned on this course of could also be an vital determinant of salt tolerance.


The halophytic plant, PorteresiacoarctataTateoka, is an in depth relative of Oryzasativa L., and has the power to face up to sudden adjustments within the soil salinity. The interpretation initiation issue 1 (PceIF1) cDNA was remoted from the leaves of P. coarctata that had been subjected to a high-salt therapy (150 mm NaCl). An expression examine confirmed that the abundance of eIF1 transcripts elevated to a most degree 5 d after stress induction after which decreased to ranges much like leaves of management (unsalinised) crops.


This gene was additionally up-regulated in exogenous abscisic acid (ABA) and mannitol therapies, suggesting that its induction is expounded to the water deficit impact of excessive salt. Our research confirmed that expression ranges of eIF1 transcripts would possibly kind a handy indicator for monitoring a stress-responsive mechanism that operates within the leaves of P. coarctata.

Search for viral agents in cerebrospinal fluid in patients with multiple sclerosis using real-time PCR and metagenomics


Multiple sclerosis (MS) is a chronic, immune-mediated demyelinating disease of the central nervous system of unclear etiology, but there is some evidence that viral infections could be responsible for triggering autoimmune mechanisms against myelin. We searched for viral RNA and DNA in cerebrospinal fluid (CSF) of 34 MS patients and 13 controls using RT-PCR/PCR against common neurotropic viruses.
In addition, shotgun DNA- and RNA-based metagenomics were done in 13 MS patients and 4 controls. Specific quantitative real-time RT-PCR/PCR testing revealed the presence of viral nucleic acid in seven (20.59%) MS patients and in one (7.69%) control patient. In MS patients the most frequently detected was human herpesvirus type 6 (HHV-6; 3 cases; 8.82%); followed by Epstein-Barr virus (EBV; 2 cases; 5.88%), varicella zoster virus (VZV; 1 case; 2.94%) and Enterovirus (EV; 1 case; 2.94%). The single identified virus among controls was EBV (7.69%).
DNA and RNA metagenomic assays did not identify any known eukaryotic viruses even though three of the analyzed samples were low-level positive by specific quantitative real-time PCR.
In conclusion, we detected the presence of Herpesviridae and occasionally Enteroviridae in CSF from patients with MS but their prevalence was not significantly higher than among controls. Metagenomic analysis seems to be less sensitive than real-time RT-PCR/PCR and it did not detect any potential viral pathogens.

WDR78 cloning plasmid

CSB-CL719620HU2-10ug 10ug
EUR 822.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2547
  • Sequence: atgacgcccggcaaacattccggagcctcggcccgagccgctaacgcaggagcttgggggtacagggacttcagaggcggccaaaaaaaggggtggtggaccactccccagctggtcgccaccatgccagtctctccggcaggcagtcacaagcagcagaacttcgggttgaaca
  • Show more
Description: A cloning plasmid for the WDR78 gene.

Rat WDR78 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse WDR78 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human WDR78 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Wdr78 ORF Vector (Rat) (pORF)

ORF079111 1.0 ug DNA
EUR 506.00

WDR78 ORF Vector (Human) (pORF)

ORF011578 1.0 ug DNA
EUR 95.00

WDR78 ORF Vector (Human) (pORF)

ORF014948 1.0 ug DNA
EUR 354.00

Wdr78 ORF Vector (Mouse) (pORF)

ORF061805 1.0 ug DNA
EUR 506.00

WDR78 sgRNA CRISPR Lentivector set (Human)

K2635401 3 x 1.0 ug
EUR 339.00

Wdr78 sgRNA CRISPR Lentivector set (Mouse)

K4526301 3 x 1.0 ug
EUR 339.00

Wdr78 sgRNA CRISPR Lentivector set (Rat)

K6359901 3 x 1.0 ug
EUR 339.00

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Evo? cDNA Kit

EUR 294.00

Evo? cDNA Kit

EUR 234.00

Novo? cDNA Kit

EUR 354.00

Novo? cDNA Kit

EUR 267.00

Evo? cDNA Supermix

EUR 381.00

Evo? cDNA Supermix

EUR 267.00

Novo? cDNA Supermix

EUR 441.00

Novo? cDNA Supermix

EUR 289.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

WD Repeat-Containing Protein 78 (WDR78) Antibody

abx037278-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

WDR78 sgRNA CRISPR Lentivector (Human) (Target 1)

K2635402 1.0 ug DNA
EUR 154.00

WDR78 sgRNA CRISPR Lentivector (Human) (Target 2)

K2635403 1.0 ug DNA
EUR 154.00

WDR78 sgRNA CRISPR Lentivector (Human) (Target 3)

K2635404 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4526302 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4526303 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4526304 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6359902 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6359903 1.0 ug DNA
EUR 154.00

Wdr78 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6359904 1.0 ug DNA
EUR 154.00

WDR78 Protein Vector (Human) (pPB-C-His)

PV059789 500 ng
EUR 481.00

WDR78 Protein Vector (Human) (pPB-N-His)

PV059790 500 ng
EUR 481.00

WDR78 Protein Vector (Human) (pPM-C-HA)

PV059791 500 ng
EUR 481.00

WDR78 Protein Vector (Human) (pPM-C-His)

PV059792 500 ng
EUR 481.00

WDR78 Protein Vector (Human) (pPB-C-His)

PV046309 500 ng
EUR 329.00

WDR78 Protein Vector (Human) (pPB-N-His)

PV046310 500 ng
EUR 329.00

WDR78 Protein Vector (Human) (pPM-C-HA)

PV046311 500 ng
EUR 329.00

WDR78 Protein Vector (Human) (pPM-C-His)

PV046312 500 ng
EUR 329.00

WDR78 Protein Vector (Rat) (pPB-C-His)

PV316442 500 ng
EUR 1166.00

WDR78 Protein Vector (Rat) (pPB-N-His)

PV316443 500 ng
EUR 1166.00

WDR78 Protein Vector (Rat) (pPM-C-HA)

PV316444 500 ng
EUR 1166.00

WDR78 Protein Vector (Rat) (pPM-C-His)

PV316445 500 ng
EUR 1166.00

WDR78 Protein Vector (Mouse) (pPB-C-His)

PV247218 500 ng
EUR 1065.00

WDR78 Protein Vector (Mouse) (pPB-N-His)

PV247219 500 ng
EUR 1065.00

WDR78 Protein Vector (Mouse) (pPM-C-HA)

PV247220 500 ng
EUR 1065.00

WDR78 Protein Vector (Mouse) (pPM-C-His)

PV247221 500 ng
EUR 1065.00

Wdr78 3'UTR GFP Stable Cell Line

TU172263 1.0 ml Ask for price

WDR78 3'UTR GFP Stable Cell Line

TU078449 1.0 ml
EUR 1394.00

Wdr78 3'UTR Luciferase Stable Cell Line

TU122263 1.0 ml Ask for price

WDR78 3'UTR Luciferase Stable Cell Line

TU028449 1.0 ml
EUR 1394.00

Wdr78 3'UTR Luciferase Stable Cell Line

TU223372 1.0 ml Ask for price

Wdr78 3'UTR GFP Stable Cell Line

TU273372 1.0 ml Ask for price

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.

cDNA Probe Diluent Solution

AR0063 5mL
EUR 106.00

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169.00

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309.00

Human eNOS cDNA probe

eNOS51-D-2 2 ug
EUR 445.00

Plant Tissue cDNA: Arabidopsis

PC34-310 10 rxn
EUR 415.00

Novo? Transcriptome cDNA Kit

EUR 952.00

Novo? Transcriptome cDNA Kit

EUR 441.00

WDR78 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664135 1.0 ug DNA
EUR 1355.00

WDR78 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664139 1.0 ug DNA
EUR 1355.00

WDR78 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664140 1.0 ug DNA
EUR 1355.00

WDR78 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702027 1.0 ug DNA
EUR 450.00

WDR78 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702031 1.0 ug DNA
EUR 450.00

WDR78 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702032 1.0 ug DNA
EUR 450.00

cDNA from Alzheimer's Disease: Brain

C1236035Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart

C1236122Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum

C1236130Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney

C1236142Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver

C1236149Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung

C1236152Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung

C1236152Ld-5 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm

C1236169Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas

C1236188Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin

C1236218Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine

C1236226Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord

C1236234Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen

C1236246Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA

HT05-090 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Lung

HA-152 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Skin

HA-218 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Testis

HA-260 10 rxn
EUR 415.00

Total-Transcriptome cDNA Synthesis Kit

G904 25 reactions
EUR 224.00

Total-Transcriptome cDNA Synthesis Kit

G905 100 reactions
EUR 544.00

Mouse iNOS (macrophage) cDNA probe

iNOS61-D-2 2 ug
EUR 445.00

cDNA Synthesis SuperMix for qPCR

  • EUR 690.00
  • EUR 565.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Monkey (Rhesus) cDNA Tissue: Thyroid

MR34-265 10 rxn
EUR 415.00

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Evo? cDNA Kit (gDNA Removal)

EUR 381.00

amfiRivert cDNA Synthesis Master Mix

R5101-050 50 rxns
EUR 415.00

amfiRivert cDNA Synthesis Master Mix

R5101-100 2X50 rxns
EUR 847.00

amfiRivert cDNA Synthesis Master Mix

R5101-200 4X50 rxns
EUR 1211.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 500ul
EUR 134.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 2x500ul
EUR 192.00

Human WD repeat- containing protein 78, WDR78 ELISA KIT

ELI-28748h 96 Tests
EUR 824.00

pCDH-CMV-MCS-EF1-Puro cDNA Vector cDNA Clon/Exp Vector [pre-packaged virus]

CD510VB-1 >1 x 10^6 IFUs
EUR 786.00
  • Category: Lentiviral Technology

All-in-One cDNA Synthesis SuperMix

B24403 200 ractions
EUR 456.00
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix

B24408 1000 ractions
EUR 1453.00
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions

AZ-1995 25 Reactions
EUR 153.00

AzuraQuant cDNA Synthesis Kit - 100 Reactions

AZ-1996 100 Reactions
EUR 372.00

cDNA from Human Tumor Tissue: Adrenal

C1235004-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bladder

C1235010-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Bone

C1235023-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Brain

C1235035-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Breast

C1235086 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Colon

C1235090 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Kidney

C1235142 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Liver

C1235149 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lung

C1235152 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Lymphoma

C1235161-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Mesenchymoma

C1235164-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Nose

C1235178-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Ovary

C1235183-10 10 reactions
EUR 494.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Pancreas

C1235188-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Parathyroid

C1235189-10 10 reactions
EUR 494.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Prostate

C1235201-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Rectum

C1235206-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Skin

C1235218-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Melanoma

C1235218A-10 10 reactions
EUR 282.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Stomach

C1235248 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Tumor Tissue: Uterus

C1235274 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Brain

C1236035Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Multiple Sclerosis Disease: Brain

C1236035Msc 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Amygdala

C1236036Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Cerebellum

C1236039Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Hippocampus

C1236052Alz 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain: Hippocampus

C1236052Par 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Pons

C1236071Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Alzheimer's Disease: Brain: Thalamus

C1236079Alz 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Colon

C1236090Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Esophagus

C1236106Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Heart

C1236122Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congenital heart disease: Heart

C1236122Hd-3 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Coronary Artery Atherosclerosis: Heart

C1236122Hd-5 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congestive Heart Failure: Heart

C1236122Hd-6 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, left

C1236126Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Atrium, right

C1236127Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, left

C1236138Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart Ventricle, right

C1236139Hd-2 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Kidney

C1236142Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Liver

C1236149Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Left Lobe

C1236150Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver: Right Lobe

C1236151Lup 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Lung

C1236152Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lymph Node

C1236161Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Pancreas

C1236188Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Skin

C1236218Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Small Intestine

C1236226Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spinal Cord

C1236234Lcs 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Spleen

C1236246Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Human Diabetic Tissue: Stomach

C1236248Dia 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Rat Normal Tissue: Adipose

C1434003 40 reactions
EUR 540.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.