Identification of cell inhibitors in opposition to Chikungunya virus replication by a cDNA expression cloning blended with MinION sequencing
- cDNA expression cloning has been confirmed to be a robust technique inside the look for cell parts that administration virus replication. On this look at, cDNA library screening using a pool of cDNA derived from interferon-treated human cells was blended with the MinION sequencer to determine cell genes inhibiting Chikungunya virus (CHIKV) replication.
- Downside an an infection of CHIKV to Vero cells transduced with the cDNA library produced virus-resistant cells. Then, the MinION sequence of cDNAs extracted from the surviving cells revealed that the open finding out frames of TOM7, S100A16, N-terminally truncated kind of ECI1 (ECI1ΔN59), and RPL29 have been inserted in plenty of the cells.
- Importantly, the transient expression of TOM7, S100A16, and ECI1ΔN59 was found to inhibit the replication of CHIKV in Huh7 cells, indicating that these cell parts have been doubtlessly anti-CHIKV molecules.
- Thus, our look at demonstrated that cDNA expression cloning blended with the MinION sequencer allowed a quick and full detection of cell inhibitors in opposition to CHIKV.

asean-ndi
XPO6 Antibody |
1-CSB-PA026224GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against XPO6. Recognizes XPO6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
XPO6 siRNA |
20-abx940017 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
XPO6 siRNA |
20-abx940018 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
XPO6 Rabbit pAb |
A10401-100ul |
Abclonal |
100 ul |
EUR 308.00 |
XPO6 Rabbit pAb |
A10401-200ul |
Abclonal |
200 ul |
EUR 459.00 |
XPO6 Rabbit pAb |
A10401-20ul |
Abclonal |
20 ul |
EUR 183.00 |
XPO6 Rabbit pAb |
A10401-50ul |
Abclonal |
50 ul |
EUR 223.00 |
XPO6 Blocking Peptide |
DF12799-BP |
Affbiotech |
1mg |
EUR 195.00 |
XPO6 Conjugated Antibody |
C46712 |
SAB |
100ul |
EUR 397.00 |
XPO6 cloning plasmid |
CSB-CL842747HU1-10ug |
Cusabio |
10ug |
EUR 814.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2514
- Sequence: atggcgtcagttaacggcagcagccagaactgtgtctcgggtcaggagcgcggccggctgggggtcctggccatgtcctgcatcaatgaactcatgtccaagaactgtgtgcctatggaatttgaggagtatttactgcgtatgttccagcagactttctacctcctgcagaaaa
- Show more
|
Description: A cloning plasmid for the XPO6 gene. |
XPO6 cloning plasmid |
CSB-CL842747HU2-10ug |
Cusabio |
10ug |
EUR 1202.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3378
- Sequence: atggcatctgaagaagcctctctcagggcattggaaagtctgatgacagaattttttcacgattgtacaaccaatgaaagaaaacgtgagatagaggagcttcttaataactttgcccagcaaataggagcctggagattctgcctgtactttctctccagcactaggaatgact
- Show more
|
Description: A cloning plasmid for the XPO6 gene. |
anti- XPO6 antibody |
FNab09550 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: IHC: 1:10-1:100
- IP: 1:200-1:1000
- Immunogen: exportin 6
- Uniprot ID: Q96QU8
- Gene ID: 23214
- Research Area: Signal Transduction
|
Description: Antibody raised against XPO6 |
Anti-XPO6 antibody |
STJ112437 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. |
Exportin 6 (XPO6) Antibody |
20-abx112420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Exportin-6 (XPO6) Antibody |
20-abx126798 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Exportin-6 (XPO6) Antibody |
abx037309-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Exportin-6 (XPO6) Antibody |
abx239550-100ug |
Abbexa |
100 ug |
EUR 481.00 |
- Shipped within 5-12 working days.
|
Mouse XPO6 shRNA Plasmid |
20-abx978151 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Exportin-6 (XPO6) Antibody |
20-abx321354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human XPO6 shRNA Plasmid |
20-abx958092 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Exportin 6 (XPO6) Protein |
20-abx650936 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
|
- Shipped within 5-7 working days.
|
Xpo6 ORF Vector (Mouse) (pORF) |
ORF061968 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Xpo6 ORF Vector (Rat) (pORF) |
ORF079217 |
ABM |
1.0 ug DNA |
EUR 506.00 |
XPO6 ORF Vector (Human) (pORF) |
ORF014966 |
ABM |
1.0 ug DNA |
EUR 354.00 |
XPO6 ORF Vector (Human) (pORF) |
ORF011649 |
ABM |
1.0 ug DNA |
EUR 95.00 |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Novo? cDNA Kit |
M1165-100 |
Biovision |
|
EUR 354.00 |
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381.00 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267.00 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441.00 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289.00 |
Human Exportin-6 (XPO6) ELISA Kit |
abx384332-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
Xpo6 sgRNA CRISPR Lentivector set (Mouse) |
K4963501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Xpo6 sgRNA CRISPR Lentivector set (Rat) |
K6323501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
XPO6 sgRNA CRISPR Lentivector set (Human) |
K2650901 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4963502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4963503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4963504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6323502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6323503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6323504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
XPO6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2650902 |
ABM |
1.0 ug DNA |
EUR 154.00 |
XPO6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2650903 |
ABM |
1.0 ug DNA |
EUR 154.00 |
XPO6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2650904 |
ABM |
1.0 ug DNA |
EUR 154.00 |
XPO6 Protein Vector (Mouse) (pPB-C-His) |
PV247870 |
ABM |
500 ng |
EUR 1065.00 |
XPO6 Protein Vector (Mouse) (pPB-N-His) |
PV247871 |
ABM |
500 ng |
EUR 1065.00 |
XPO6 Protein Vector (Mouse) (pPM-C-HA) |
PV247872 |
ABM |
500 ng |
EUR 1065.00 |
XPO6 Protein Vector (Mouse) (pPM-C-His) |
PV247873 |
ABM |
500 ng |
EUR 1065.00 |
XPO6 Protein Vector (Rat) (pPB-C-His) |
PV316866 |
ABM |
500 ng |
EUR 1191.00 |
XPO6 Protein Vector (Rat) (pPB-N-His) |
PV316867 |
ABM |
500 ng |
EUR 1191.00 |
XPO6 Protein Vector (Rat) (pPM-C-HA) |
PV316868 |
ABM |
500 ng |
EUR 1191.00 |
XPO6 Protein Vector (Rat) (pPM-C-His) |
PV316869 |
ABM |
500 ng |
EUR 1191.00 |
XPO6 Protein Vector (Human) (pPB-C-His) |
PV059861 |
ABM |
500 ng |
EUR 481.00 |
XPO6 Protein Vector (Human) (pPB-N-His) |
PV059862 |
ABM |
500 ng |
EUR 481.00 |
XPO6 Protein Vector (Human) (pPM-C-HA) |
PV059863 |
ABM |
500 ng |
EUR 481.00 |
XPO6 Protein Vector (Human) (pPM-C-His) |
PV059864 |
ABM |
500 ng |
EUR 481.00 |
XPO6 Protein Vector (Human) (pPB-C-His) |
PV046593 |
ABM |
500 ng |
EUR 329.00 |
XPO6 Protein Vector (Human) (pPB-N-His) |
PV046594 |
ABM |
500 ng |
EUR 329.00 |
XPO6 Protein Vector (Human) (pPM-C-HA) |
PV046595 |
ABM |
500 ng |
EUR 329.00 |
XPO6 Protein Vector (Human) (pPM-C-His) |
PV046596 |
ABM |
500 ng |
EUR 329.00 |
Xpo6 3'UTR Luciferase Stable Cell Line |
TU122394 |
ABM |
1.0 ml |
Ask for price |
XPO6 3'UTR GFP Stable Cell Line |
TU078606 |
ABM |
1.0 ml |
EUR 1394.00 |
Xpo6 3'UTR GFP Stable Cell Line |
TU172394 |
ABM |
1.0 ml |
Ask for price |
Xpo6 3'UTR Luciferase Stable Cell Line |
TU223481 |
ABM |
1.0 ml |
Ask for price |
XPO6 3'UTR Luciferase Stable Cell Line |
TU028606 |
ABM |
1.0 ml |
EUR 1394.00 |
Xpo6 3'UTR GFP Stable Cell Line |
TU273481 |
ABM |
1.0 ml |
Ask for price |
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106.00 |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Identification of a novel KIR3DL3*064 allele by cDNA cloning and sequencing
Purpose: To report on a novel KIR3DL3 allele acknowledged in a southern Han Chinese language language explicit individual.
Methods: Peripheral blood sample was collected from a voluntary blood donor with inconclusive final result by KIR3DL3 sequence-based typing (SBT). Entire mRNA was extracted and subjected to reverse transcription to amass KIR3DL3 cDNA, which was then amplified by PCR with a pair of KIR3DL3-specific primers. The product was subjected to cDNA cloning and sequencing.
Outcomes: cDNA cloning and sequencing have acknowledged a wide-type KIR3DL3*00802 allele and a novel KIR3DL3*064 allele. The latter differed from KIR3DL3*00601 by a missense variant at codon 374[c.1184 C>T (p.Thr374Ile)] in exon 9. The novel KIR3DL3 allele has been formally assigned by the KIR subcommittee of World Nicely being Group Nomenclature Committee for parts of HLA system.
Conclusion: cDNA cloning and sequencing is also used to inform aside inconclusive ends in KIR3DL3 SBT with a objective to determine novel KIR alleles.
Apple Russet Ring and Apple Inexperienced Crinkle Sicknesses: Achievement of Koch’s Postulates by Virome Analysis, Amplification of Full-Measurement cDNA of Viral Genomes, in vitro Transcription of Infectious Viral RNAs, and Duplicate of Indicators on Fruits of Apple Bushes Inoculated With Viral RNAs
Apple russet ring and apple inexperienced crinkle are graft-transmitted sicknesses first reported larger than 60 years up to now, nevertheless at present, no affiliation between a particular virus (variant) and the sickness has been clearly demonstrated.
On this look at, we carried out the subsequent assortment of experiments to determine the causal viruses (variants) of these apple sicknesses; (1) full analysis by next-generation sequencing of all viruses in each apple tree affected with russet ring or inexperienced crinkle sickness,
(2) amplification of full-length genomic cDNA of viruses using primers containing the T3 promoter and the in vitro transcription of infectious viral RNAs, (3) inoculation of viral RNA transcripts to every herbaceous and apple crops, (4) analysis of sequence variants of viruses present in contaminated crops, (5) back-inoculation of sequence variants of candidate viruses to apple seedlings blended with the virus-induced flowering know-how using the apple latent spherical virus vector to breed the symptom on the fruit as rapidly as doable, and
(6) reproduction of indicators on the fruits of apple timber inoculated with sequence variants and the re-isolation of each virus variant from apples exhibiting fruit indicators.
The outcomes confirmed that certainly one of many sequence variants of the apple chlorotic leaf spot virus causes a attribute ring-shaped rust on the fruits of contaminated apple timber and {{that a}} sequence variant of the apple stem pitting virus possibly causes inexperienced crinkle indicators on an contaminated apple fruit.
Thus, now we have been able to fulfill Koch’s postulates to point out the viral etiology of every the apple russet ring and inexperienced crinkle sicknesses. We moreover counsel an experimental system which will present whether or not or not a virus current in diseased tissues is the pathogen responsible for the sicknesses when the etiology is undetermined.
Optimistic RT-PCR Take a look at Leads to 420 Sufferers Recovered From COVID-19 in Wuhan: An Observational Research
Goal: In the course of the follow-up of sufferers recovered from coronavirus illness 2019 (COVID-19) within the quarantine and remark interval, a number of the cured sufferers confirmed constructive outcomes once more. The recurrent constructive RT-PCR check outcomes drew widespread concern. We noticed a sure variety of cured COVID-19 sufferers with constructive RT-PCR check outcomes and attempt to analyze the components that brought on the phenomenon.
Strategies: We carried out an observational research in COVID-19 sufferers discharged from 6 rehabilitation stations in Wuhan, China. All noticed topics met the standards for hospital discharge and had been in quarantine. Knowledge relating to age, intercourse, physique mass index (BMI), course of illness, comorbidity, smoking standing and alcohol consumption, signs out and in of quarantine, and intervention had been collected from the topics’ medical information and descriptively analyzed.
The primary final result of this research was the RT-PCR check results of the noticed topics on the finish of quarantine (unfavourable or constructive). Logistic regression evaluation was used to determine the influencing components associated to recurrent constructive RT-PCR check outcomes.
Outcomes: On this observational research, 420 noticed topics recovered from COVID-19 had been included. The median age was 56 years, 63.6% of the topics had been above 50 years previous, and 50.7% (213/420) had been feminine.
The commonest comorbidities had been hypertension [26.4% (111/420)], hyperlipidemia [10.7% (45/420)], and diabetes [10.5% (44/420)]. 54.8% (230/420) manifested a number of signs initially of the remark interval, the commonest signs had been cough [27.6% (116/420)], shortness of breath 23.8% (100/420)], and fatigue [16.2% (68/420)], with fever uncommon [2.6% (11/420)]. A complete of 325 topics had been uncovered to complete intervention; 95 topics had been absence of intervention.
The recurrence price of constructive RT-PCR check outcomes with complete intervention was 2.8% (9/325), and that with no intervention was 15.8% (15/95).
The outcomes of logistic regression evaluation confirmed that after adjusted for components similar to age, intercourse, and comorbidity and came upon that complete intervention was correlated with the recurrent constructive RT-PCR check outcomes. There was appreciably much less recurrence within the complete intervention group.
Conclusions: The components associated to constructive RT-PCR check ends in noticed topics recovered from COVID-19 had been age, comorbidity, and complete intervention, amongst which complete intervention is perhaps a protecting issue.
Medical trial registration: Chictr.org.cn, identifier ChiCTR2000030747.
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544.00 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756.00 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583.00 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RDR-PLTP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811.00 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521.00 |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723.00 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557.00 |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
RD-PLTP-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775.00 |
Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4 |
AMR09390G |
Leading Biology |
0.1mg |
EUR 484.00 |
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC |
PLTP antibody |
70R-10288 |
Fitzgerald |
50 ug |
EUR 467.00 |
Description: Affinity purified rabbit polyclonal PLTP antibody |
PLTP antibody |
70R-11938 |
Fitzgerald |
100 ug |
EUR 418.00 |
Description: Rabbit polyclonal PLTP antibody |
PLTP Antibody |
32933-100ul |
SAB |
100ul |
EUR 252.00 |
PLTP Antibody |
DF7426 |
Affbiotech |
200ul |
EUR 304.00 |
Description: PLTP Antibody detects endogenous levels of total PLTP. |
PLTP Antibody |
1-CSB-PA253412 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
PLTP Antibody |
1-CSB-PA018212EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PLTP siRNA |
20-abx928999 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLTP siRNA |
20-abx929000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PLTP |
YF-PA13839 |
Abfrontier |
50 ul |
EUR 363.00 |
Description: Mouse polyclonal to PLTP |
anti-PLTP |
YF-PA13840 |
Abfrontier |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal to PLTP |
anti-PLTP |
YF-PA24404 |
Abfrontier |
50 ul |
EUR 334.00 |
Description: Mouse polyclonal to PLTP |
Recombinant Phospholipid Transfer Protein (PLTP) |
4-RPC728Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
|
- Uniprot ID: P55065
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.4kDa
- Isoelectric Point: 10.1
|
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli |
Recombinant Phospholipid Transfer Protein (PLTP) |
4-RPC728Ra01 |
Cloud-Clone |
-
EUR 469.15
-
EUR 229.00
-
EUR 1484.32
-
EUR 561.44
-
EUR 1022.88
-
EUR 377.00
-
EUR 3560.80
|
|
- Uniprot ID: E9PSP1
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli |
PLTP Blocking Peptide |
33R-10824 |
Fitzgerald |
50 ug |
EUR 191.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938 |
PLTP Blocking Peptide |
3595BP-50 |
Biovision |
|
EUR 153.00 |
PLTP Blocking Peptide |
33R-6693 |
Fitzgerald |
100 ug |
EUR 180.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288 |
Polyclonal PLTP Antibody |
AMR09385G |
Leading Biology |
0.05mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications: |
Polyclonal PLTP Antibody |
AMR09386G |
Leading Biology |
0.1mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications: |
Polyclonal PLTP Antibody |
AMR09387G |
Leading Biology |
0.05mg |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications: |
PLTP Blocking Peptide |
DF7426-BP |
Affbiotech |
1mg |
EUR 195.00 |
PLTP Conjugated Antibody |
C32933 |
SAB |
100ul |
EUR 397.00 |
PLTP cloning plasmid |
CSB-CL018212HU1-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1482
- Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
- Show more
|
Description: A cloning plasmid for the PLTP gene. |
PLTP cloning plasmid |
CSB-CL018212HU2-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1326
- Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
- Show more
|
Description: A cloning plasmid for the PLTP gene. |
PLTP Rabbit pAb |
A5628-100ul |
Abclonal |
100 ul |
EUR 308.00 |
PLTP Rabbit pAb |
A5628-200ul |
Abclonal |
200 ul |
EUR 459.00 |
PLTP Rabbit pAb |
A5628-20ul |
Abclonal |
20 ul |
EUR 183.00 |
PLTP Rabbit pAb |
A5628-50ul |
Abclonal |
50 ul |
EUR 223.00 |
PLTP Polyclonal Antibody |
A53320 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PLTP Polyclonal Antibody |
ABP59951-003ml |
Abbkine |
0.03ml |
EUR 158.00 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
ABP59951-01ml |
Abbkine |
0.1ml |
EUR 289.00 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
ABP59951-02ml |
Abbkine |
0.2ml |
EUR 414.00 |
- Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 |
PLTP Polyclonal Antibody |
ES10007-100ul |
ELK Biotech |
100ul |
EUR 279.00 |
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLTP Polyclonal Antibody |
ES10007-50ul |
ELK Biotech |
50ul |
EUR 207.00 |
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Anti-PLTP Antibody |
PA2228 |
BosterBio |
100ug/vial |
EUR 334.00 |
Anti-PLTP antibody |
STJ27595 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene. |
Anti-PLTP antibody |
STJ191165 |
St John's Laboratory |
200 µl |
EUR 197.00 |
Description: Unconjugated Rabbit polyclonal to PLTP |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse) |
4-PAC728Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP) |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat) |
4-PAC728Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP) |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.50 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.30 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639.00 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.50 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Human Phospholipid Transfer Protein (PLTP) ELISA Kit |
4-SEC728Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
|
- Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.40 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids. |
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids. |
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.40 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids. |
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.80 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids. |
Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit |
4-SEC728Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
|
- Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.20 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.20 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
SEC728Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.40 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids. |
Rat Phospholipid Transfer Protein (PLTP) ELISA Kit |
4-SEC728Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
|
- Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC |
4-PAC728Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC728Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3 |
4-PAC728Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC |
4-PAC728Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP |
4-PAC728Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE |
4-PAC728Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC |
4-PAC728Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Biotinylated |
4-PAC728Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Cy3 |
4-PAC728Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), FITC |
4-PAC728Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), HRP |
4-PAC728Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), PE |
4-PAC728Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE. |
PLTP Antibody, HRP conjugated |
1-CSB-PA018212EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLTP Antibody, FITC conjugated |
1-CSB-PA018212EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLTP Antibody, Biotin conjugated |
1-CSB-PA018212ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human PLTP ELISA Kit |
EHP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Bovine PLTP ELISA Kit |
EBP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Anserini PLTP ELISA Kit |
EAP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Chicken PLTP ELISA Kit |
ECKP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Canine PLTP ELISA Kit |
ECP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Goat PLTP ELISA Kit |
EGTP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Mouse PLTP shRNA Plasmid |
20-abx972110 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PLTP shRNA Plasmid |
20-abx953598 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Porcine PLTP ELISA Kit |
EPP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Sheep PLTP ELISA Kit |
ESP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Rat PLTP ELISA Kit |
ERP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Rabbit PLTP ELISA Kit |
ERTP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Monkey PLTP ELISA Kit |
EMKP0138 |
Abclonal |
96Tests |
EUR 521.00 |
Mouse PLTP ELISA Kit |
EMP0138 |
Abclonal |
96Tests |
EUR 521.00 |
PLTP Recombinant Protein (Human) |
RP023854 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Human) |
RP023857 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Mouse) |
RP162998 |
ABM |
100 ug |
Ask for price |
PLTP Recombinant Protein (Rat) |
RP221072 |
ABM |
100 ug |
Ask for price |
Anti-PLTP (2F3-G4) |
YF-MA10707 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to PLTP |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Novo? cDNA Kit |
M1165-100 |
Biovision |
|
EUR 354.00 |
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381.00 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267.00 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441.00 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289.00 |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC728Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Asp479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7. |
Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC728Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
|
- Sequence of the immunogen: PLTP (Ile337~Gly479)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7. |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
PLTP Inhibitor Drug Screening Kit |
55R-1448 |
Fitzgerald |
100 assays |
EUR 920.00 |
Description: Screening Kit for detection of PLTP Inhibitor in the research laboratory |
Human Phospholipid transfer protein (PLTP) |
1-CSB-EP018212HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
|
- MW: 80.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in E.coli |
Human Phospholipid transfer protein (PLTP) |
1-CSB-YP018212HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
|
- MW: 55.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in Yeast |
Polyclonal PLTP Antibody (aa470-490) |
AMR09388G |
Leading Biology |
0.05ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (aa470-490). This antibody is tested and proven to work in the following applications: |
Polyclonal PLTP Antibody (C-term) |
AMR09389G |
Leading Biology |
0.1ml |
EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (C-term). This antibody is tested and proven to work in the following applications: |
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx004303 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx178016 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx178017 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx212015 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx131266 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
|
- Shipped within 5-7 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx131267 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
|
- Shipped within 5-7 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx146426-100ug |
Abbexa |
100 ug |
EUR 391.00 |
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx142148 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx174059 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
20-abx174060 |
Abbexa |
|
|
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx033529-400ul |
Abbexa |
400 ul |
EUR 523.00 |
- Shipped within 5-10 working days.
|
Phospholipid Transfer Protein (PLTP) Antibody |
abx033529-80l |
Abbexa |
80 µl |
EUR 286.00 |
- Shipped within 5-10 working days.
|
ELISA kit for Mouse PLTP |
EK5632 |
SAB |
96 tests |
EUR 553.00 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse PLTP in samples from serum, plasma, tissue homogenates and other biological fluids. |
Mouse PLTP PicoKine ELISA Kit |
EK1368 |
BosterBio |
96 wells |
EUR 425.00 |
Description: For quantitative detection of mouse PLTP in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
Guinea Pig PLTP ELISA Kit |
EGP0138 |
Abclonal |
96Tests |
EUR 521.00 |
PLTP Polyclonal Antibody, Biotin Conjugated |
A53317 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PLTP Polyclonal Antibody, FITC Conjugated |
A53318 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PLTP Polyclonal Antibody, HRP Conjugated |
A53319 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PLTP Activity Fluorometric Assay Kit |
K2087-100 |
ApexBio |
100 assays |
EUR 669.00 |
Pltp ORF Vector (Rat) (pORF) |
ORF073692 |
ABM |
1.0 ug DNA |
EUR 506.00 |
PLTP ORF Vector (Human) (pORF) |
ORF007952 |
ABM |
1.0 ug DNA |
EUR 95.00 |
PLTP ORF Vector (Human) (pORF) |
ORF007953 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Pltp ORF Vector (Mouse) (pORF) |
ORF054334 |
ABM |
1.0 ug DNA |
EUR 506.00 |
PLTP ELISA Kit (Human) (OKAN06516) |
OKAN06516 |
Aviva Systems Biology |
96 Wells |
EUR 792.00 |
Description: Description of target: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL |
PLTP ELISA Kit (Human) (OKCD01695) |
OKCD01695 |
Aviva Systems Biology |
96 Wells |
EUR 831.00 |
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL |
PLTP ELISA Kit (Mouse) (OKBB00625) |
OKBB00625 |
Aviva Systems Biology |
96 Wells |
EUR 505.00 |
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL |
PLTP ELISA Kit (Human) (OKCA02131) |
OKCA02131 |
Aviva Systems Biology |
96 Wells |
EUR 917.00 |
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.58 ng/mL |
PLTP ELISA Kit (Rat) (OKCD04388) |
OKCD04388 |
Aviva Systems Biology |
96 Wells |
EUR 936.00 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.4 ng/mL |
PLTP ELISA Kit (Mouse) (OKCD08236) |
OKCD08236 |
Aviva Systems Biology |
96 Wells |
EUR 1001.00 |
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106.00 |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Asthma: Lung |
C1236152Ld-1 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Bronchitis: Lung |
C1236152Ld-2 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Emphysema: Lung |
C1236152Ld-3 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pneumonia: Lung |
C1236152Ld-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Tags:
cdna amd,
cdna application,
cdna avm,
cdna for qpcr,
cdna library,
cdna sbs,
cdna sequence,
cdna sequencing,
cdna stock,
cdna stock price,
cdna synthesis,
cdna synthesis pcr,
cdna synthesis protocol,
cdna vs genomic,
cdna vs genomic dna,
cdna.tv,
cdna2,
cdnacp,
cdnaf,
cdname,
cdnap,
cdnaturally