Identification of mobile inhibitors in opposition to Chikungunya virus replication by a cDNA

Identification of cell inhibitors in opposition to Chikungunya virus replication by a cDNA expression cloning blended with MinION sequencing

 

• cDNA expression cloning has been confirmed to be a robust technique inside the look for cell parts that administration virus replication. On this look at, cDNA library screening using a pool of cDNA derived from interferon-treated human cells was blended with the MinION sequencer to determine cell genes inhibiting Chikungunya virus (CHIKV) replication.

 

• Downside an an infection of CHIKV to Vero cells transduced with the cDNA library produced virus-resistant cells. Then, the MinION sequence of cDNAs extracted from the surviving cells revealed that the open finding out frames of TOM7, S100A16, N-terminally truncated kind of ECI1 (ECI1ΔN59), and RPL29 have been inserted in plenty of the cells.

 

• Importantly, the transient expression of TOM7, S100A16, and ECI1ΔN59 was found to inhibit the replication of CHIKV in Huh7 cells, indicating that these cell parts have been doubtlessly anti-CHIKV molecules.

 

• Thus, our look at demonstrated that cDNA expression cloning blended with the MinION sequencer allowed a quick and full detection of cell inhibitors in opposition to CHIKV.

XPO6 Antibody
1-CSB-PA026224GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against XPO6. Recognizes XPO6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

XPO6 siRNA
20-abx940017	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

XPO6 siRNA
20-abx940018	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

XPO6 Rabbit pAb
A10401-100ul	Abclonal	100 ul	EUR 308

XPO6 Rabbit pAb
A10401-200ul	Abclonal	200 ul	EUR 459

XPO6 Rabbit pAb
A10401-20ul	Abclonal	20 ul	EUR 183

XPO6 Rabbit pAb
A10401-50ul	Abclonal	50 ul	EUR 223

XPO6 Blocking Peptide
DF12799-BP	Affbiotech	1mg	EUR 195

XPO6 Conjugated Antibody
C46712	SAB	100ul	EUR 397

XPO6 cloning plasmid
CSB-CL842747HU1-10ug	Cusabio	10ug	EUR 814
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2514 Sequence: atggcgtcagttaacggcagcagccagaactgtgtctcgggtcaggagcgcggccggctgggggtcctggccatgtcctgcatcaatgaactcatgtccaagaactgtgtgcctatggaatttgaggagtatttactgcgtatgttccagcagactttctacctcctgcagaaaa Show more
Description: A cloning plasmid for the XPO6 gene.

XPO6 cloning plasmid
CSB-CL842747HU2-10ug	Cusabio	10ug	EUR 1202
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3378 Sequence: atggcatctgaagaagcctctctcagggcattggaaagtctgatgacagaattttttcacgattgtacaaccaatgaaagaaaacgtgagatagaggagcttcttaataactttgcccagcaaataggagcctggagattctgcctgtactttctctccagcactaggaatgact Show more
Description: A cloning plasmid for the XPO6 gene.

anti- XPO6 antibody
FNab09550	FN Test	100µg	EUR 505.25
Recommended dilution: IHC: 1:10-1:100 IP: 1:200-1:1000 Immunogen: exportin 6 Uniprot ID: Q96QU8 Gene ID: 23214 Research Area: Signal Transduction
Description: Antibody raised against XPO6

Anti-XPO6 antibody
PAab09550	Lifescience Market	100 ug	EUR 355

Anti-XPO6 antibody
STJ112437	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-XPO6 antibody
STJ13100475	St John's Laboratory	100 µl	EUR 427

Exportin 6 (XPO6) Antibody
20-abx112420	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody
20-abx126798	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody
abx037309-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Exportin-6 (XPO6) Antibody
abx239550-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

XPO6 ELISA KIT|Human
EF004323	Lifescience Market	96 Tests	EUR 689

Mouse XPO6 shRNA Plasmid
20-abx978151	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Exportin-6 (XPO6) Antibody
20-abx321354	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Human XPO6 shRNA Plasmid
20-abx958092	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Exportin 6 (XPO6) Protein
20-abx650936	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Xpo6 ORF Vector (Mouse) (pORF)
ORF061968	ABM	1.0 ug DNA	EUR 506

Xpo6 ORF Vector (Rat) (pORF)
ORF079217	ABM	1.0 ug DNA	EUR 506

XPO6 ORF Vector (Human) (pORF)
ORF014966	ABM	1.0 ug DNA	EUR 354

XPO6 ORF Vector (Human) (pORF)
ORF011649	ABM	1.0 ug DNA	EUR 95

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

Human Exportin- 6, XPO6 ELISA KIT
ELI-17963h	Lifescience Market	96 Tests	EUR 824

Mouse Exportin- 6, Xpo6 ELISA KIT
ELI-51533m	Lifescience Market	96 Tests	EUR 865

Human Exportin-6 (XPO6) ELISA Kit
abx384332-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Xpo6 sgRNA CRISPR Lentivector set (Mouse)
K4963501	ABM	3 x 1.0 ug	EUR 339

Xpo6 sgRNA CRISPR Lentivector set (Rat)
K6323501	ABM	3 x 1.0 ug	EUR 339

XPO6 sgRNA CRISPR Lentivector set (Human)
K2650901	ABM	3 x 1.0 ug	EUR 339

Human Exportin 6(XPO6)ELISA Kit
QY-E01489	Qayee Biotechnology	96T	EUR 361

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4963502	ABM	1.0 ug DNA	EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4963503	ABM	1.0 ug DNA	EUR 154

Xpo6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4963504	ABM	1.0 ug DNA	EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6323502	ABM	1.0 ug DNA	EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6323503	ABM	1.0 ug DNA	EUR 154

Xpo6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6323504	ABM	1.0 ug DNA	EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2650902	ABM	1.0 ug DNA	EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2650903	ABM	1.0 ug DNA	EUR 154

XPO6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2650904	ABM	1.0 ug DNA	EUR 154

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

 

Identification of a novel KIR3DL3*064 allele by cDNA cloning and sequencing

Purpose: To report on a novel KIR3DL3 allele acknowledged in a southern Han Chinese language language explicit individual.

 

Methods: Peripheral blood sample was collected from a voluntary blood donor with inconclusive final result by KIR3DL3 sequence-based typing (SBT). Entire mRNA was extracted and subjected to reverse transcription to amass KIR3DL3 cDNA, which was then amplified by PCR with a pair of KIR3DL3-specific primers. The product was subjected to cDNA cloning and sequencing.

 

Outcomes: cDNA cloning and sequencing have acknowledged a wide-type KIR3DL3*00802 allele and a novel KIR3DL3*064 allele. The latter differed from KIR3DL3*00601 by a missense variant at codon 374[c.1184 C>T (p.Thr374Ile)] in exon 9. The novel KIR3DL3 allele has been formally assigned by the KIR subcommittee of World Nicely being Group Nomenclature Committee for parts of HLA system.

 

Conclusion: cDNA cloning and sequencing is also used to inform aside inconclusive ends in KIR3DL3 SBT with a objective to determine novel KIR alleles.

 

Apple Russet Ring and Apple Inexperienced Crinkle Sicknesses: Achievement of Koch’s Postulates by Virome Analysis, Amplification of Full-Measurement cDNA of Viral Genomes, in vitro Transcription of Infectious Viral RNAs, and Duplicate of Indicators on Fruits of Apple Bushes Inoculated With Viral RNAs

 

 

Apple russet ring and apple inexperienced crinkle are graft-transmitted sicknesses first reported larger than 60 years up to now, nevertheless at present, no affiliation between a particular virus (variant) and the sickness has been clearly demonstrated.

 

On this look at, we carried out the subsequent assortment of experiments to determine the causal viruses (variants) of these apple sicknesses; (1) full analysis by next-generation sequencing of all viruses in each apple tree affected with russet ring or inexperienced crinkle sickness,

 

(2) amplification of full-length genomic cDNA of viruses using primers containing the T3 promoter and the in vitro transcription of infectious viral RNAs, (3) inoculation of viral RNA transcripts to every herbaceous and apple crops, (4) analysis of sequence variants of viruses present in contaminated crops, (5) back-inoculation of sequence variants of candidate viruses to apple seedlings blended with the virus-induced flowering know-how using the apple latent spherical virus vector to breed the symptom on the fruit as rapidly as doable, and

 

(6) reproduction of indicators on the fruits of apple timber inoculated with sequence variants and the re-isolation of each virus variant from apples exhibiting fruit indicators.

 

The outcomes confirmed that certainly one of many sequence variants of the apple chlorotic leaf spot virus causes a attribute ring-shaped rust on the fruits of contaminated apple timber and {{that a}} sequence variant of the apple stem pitting virus possibly causes inexperienced crinkle indicators on an contaminated apple fruit.

 

Thus, now we have been able to fulfill Koch’s postulates to point out the viral etiology of every the apple russet ring and inexperienced crinkle sicknesses. We moreover counsel an experimental system which will present whether or not or not a virus current in diseased tissues is the pathogen responsible for the sicknesses when the etiology is undetermined.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RDR-PLTP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
RD-PLTP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4
AMR09390G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC

PLTP antibody
70R-10288	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal PLTP antibody

PLTP antibody
70R-11938	Fitzgerald	100 ug	EUR 418
Description: Rabbit polyclonal PLTP antibody

PLTP Antibody
3595-100	Biovision		EUR 327

PLTP Antibody
3595-30T	Biovision		EUR 146

PLTP Antibody
32933-100ul	SAB	100ul	EUR 252

PLTP Antibody
DF7426	Affbiotech	200ul	EUR 304
Description: PLTP Antibody detects endogenous levels of total PLTP.

PLTP Antibody
1-CSB-PA253412	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PLTP Antibody
1-CSB-PA018212EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PLTP siRNA
20-abx928999	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PLTP siRNA
20-abx929000	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PLTP Antibody
ABD7426	Lifescience Market	100 ug	EUR 438

pENTR223-PLTP
PVT12200	Lifescience Market	2 ug	EUR 391

anti-PLTP
YF-PA13839	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PLTP

anti-PLTP
YF-PA13840	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to PLTP

anti-PLTP
YF-PA24404	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PLTP

Recombinant Phospholipid Transfer Protein (PLTP)
4-RPC728Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P55065 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: 10.1
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli

Recombinant Phospholipid Transfer Protein (PLTP)
4-RPC728Ra01	Cloud-Clone	EUR 469.15 EUR 229.00 EUR 1484.32 EUR 561.44 EUR 1022.88 EUR 377.00 EUR 3560.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: E9PSP1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli

PLTP Blocking Peptide
33R-10824	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938

PLTP Blocking Peptide
3595BP-50	Biovision		EUR 153

PLTP Blocking Peptide
33R-6693	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288

Polyclonal PLTP Antibody
AMR09385G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:

Polyclonal PLTP Antibody
AMR09386G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:

Polyclonal PLTP Antibody
AMR09387G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP . This antibody is tested and proven to work in the following applications:

PLTP Blocking Peptide
DF7426-BP	Affbiotech	1mg	EUR 195

PLTP Conjugated Antibody
C32933	SAB	100ul	EUR 397

PLTP cloning plasmid
CSB-CL018212HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1482 Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag Show more
Description: A cloning plasmid for the PLTP gene.

PLTP cloning plasmid
CSB-CL018212HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1326 Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag Show more
Description: A cloning plasmid for the PLTP gene.

PLTP Rabbit pAb
A5628-100ul	Abclonal	100 ul	EUR 308

PLTP Rabbit pAb
A5628-200ul	Abclonal	200 ul	EUR 459

PLTP Rabbit pAb
A5628-20ul	Abclonal	20 ul	EUR 183

PLTP Rabbit pAb
A5628-50ul	Abclonal	50 ul	EUR 223

PLTP Polyclonal Antibody
A53320	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PLTP Polyclonal Antibody
ABP59951-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody
ABP59951-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody
ABP59951-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody
ES10007-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLTP Polyclonal Antibody
ES10007-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PLTP Antibody
PA2228	BosterBio	100ug/vial	EUR 334

Anti-PLTP antibody
STJ27595	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.

Anti-PLTP antibody
STJ191165	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PLTP

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse)
4-PAC728Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP)

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat)
4-PAC728Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP)

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit
4-SEC728Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Phospholipid Transfer Protein (PLTP) in serum, plasma and other biological fluids.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit
4-SEC728Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
SEC728Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Phospholipid Transfer Protein (PLTP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Phospholipid Transfer Protein (PLTP) in serum, plasma, tissue homogenates and other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit
4-SEC728Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Phospholipid Transfer Protein elisa. Alternative names of the recognized antigen: Lipid transfer protein II
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC
4-PAC728Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated
4-PAC728Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3
4-PAC728Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC
4-PAC728Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP
4-PAC728Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE
4-PAC728Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Asp479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC
4-PAC728Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Biotinylated
4-PAC728Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Cy3
4-PAC728Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), FITC
4-PAC728Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), HRP
4-PAC728Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), PE
4-PAC728Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PLTP (Ile337~Gly479) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.

PLTP Antibody, HRP conjugated
1-CSB-PA018212EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLTP Antibody, FITC conjugated
1-CSB-PA018212EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLTP Antibody, Biotin conjugated
1-CSB-PA018212ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PLTP ELISA Kit
EHP0138	Abclonal	96Tests	EUR 521

Bovine PLTP ELISA Kit
EBP0138	Abclonal	96Tests	EUR 521

Anserini PLTP ELISA Kit
EAP0138	Abclonal	96Tests	EUR 521

Chicken PLTP ELISA Kit
ECKP0138	Abclonal	96Tests	EUR 521

Canine PLTP ELISA Kit
ECP0138	Abclonal	96Tests	EUR 521

Goat PLTP ELISA Kit
EGTP0138	Abclonal	96Tests	EUR 521

PLTP ELISA KIT|Human
EF007098	Lifescience Market	96 Tests	EUR 689

Mouse PLTP shRNA Plasmid
20-abx972110	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PLTP shRNA Plasmid
20-abx953598	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine PLTP ELISA Kit
EPP0138	Abclonal	96Tests	EUR 521

Sheep PLTP ELISA Kit
ESP0138	Abclonal	96Tests	EUR 521

Rat PLTP ELISA Kit
ERP0138	Abclonal	96Tests	EUR 521

Rabbit PLTP ELISA Kit
ERTP0138	Abclonal	96Tests	EUR 521

Monkey PLTP ELISA Kit
EMKP0138	Abclonal	96Tests	EUR 521

Mouse PLTP ELISA Kit
EMP0138	Abclonal	96Tests	EUR 521