Skip to content
ASEAN Network for Research, Diagnostics and Vaccines Innovation

ASEAN Network for Research, Diagnostics and Vaccines Innovation

RUO lab reagent, FBS, Normal human Cell culture bovine serum

  • Home
  • hematopoietic stem cell transplantation
  • cytotoxic T lymphocyte antigen-4
  • acute graft-versus-host disease
  • cDNA expression library
  • nicking enzyme
  • ligation-independent cloning
  • Contact Us

Extraction of high-quality tissue-specific RNA from London aircraft timber

November 6, 2020
 |  No Comments
asean-ndi

Extraction of high-quality tissue-specific RNA from London aircraft timber (Platanusacerifolia), allowing the development of a feminine inflorescence cDNA library

 

  • The London aircraft tree (PlatanusacerifoliaWilld.) has international significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

 

  • An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are sure to soluble polyvinylpyrrolidone after which separated out by way of LiCl precipitation of the RNA.

 

  • Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation. The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation.

 

  • Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to include a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.
asean-ndi

asean-ndi

LILRB2 Antibody

35791-100ul SAB 100ul
EUR 252.00

LILRB2 Antibody

DF9604 Affbiotech 200ul
EUR 304.00
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

LILRB2 Antibody

1-CSB-PA943186 Cusabio
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody

1-CSB-PA006212 Cusabio
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

LILRB2 Antibody

1-CSB-PA013000LA01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200

anti-LILRB2

YF-PA16864 Abfrontier 50 ul
EUR 363.00
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16865 Abfrontier 50 ug
EUR 363.00
Description: Mouse polyclonal to LILRB2

anti-LILRB2

YF-PA16866 Abfrontier 100 ug
EUR 403.00
Description: Rabbit polyclonal to LILRB2

LILRB2 Conjugated Antibody

C35791 SAB 100ul
EUR 397.00

LILRB2 Rabbit pAb

A10135-100ul Abclonal 100 ul
EUR 308.00

LILRB2 Rabbit pAb

A10135-200ul Abclonal 200 ul
EUR 459.00

LILRB2 Rabbit pAb

A10135-20ul Abclonal 20 ul
EUR 183.00

LILRB2 Rabbit pAb

A10135-50ul Abclonal 50 ul
EUR 223.00

LILRB2 Rabbit pAb

A12157-100ul Abclonal 100 ul
EUR 308.00

LILRB2 Rabbit pAb

A12157-200ul Abclonal 200 ul
EUR 459.00

LILRB2 Rabbit pAb

A12157-20ul Abclonal 20 ul
EUR 183.00

LILRB2 Rabbit pAb

A12157-50ul Abclonal 50 ul
EUR 223.00

LILRB2 Blocking Peptide

DF9604-BP Affbiotech 1mg
EUR 195.00

LILRB2 cloning plasmid

CSB-CL839793HU-10ug Cusabio 10ug
EUR 612.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1797
  • Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc
  • Show more
Description: A cloning plasmid for the LILRB2 gene.

pDONR223-LILRB2 Plasmid

PVTB00316 Lifescience Market 2 ug
EUR 356.00

Anti-LILRB2 antibody

STJ112174 St John's Laboratory 100 µl
EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody

STJ114050 St John's Laboratory 100 µl
EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 (1D4)

YF-MA17235 Abfrontier 100 ug
EUR 363.00
Description: Mouse monoclonal to LILRB2

LILRB2 Polyclonal Conjugated Antibody

C41960 SAB 100ul
EUR 397.00

Human LILRB2 ELISA Kit

ELA-E7745h Lifescience Market 96 Tests
EUR 824.00

Human LILRB2 ELISA KIT

ELI-27802h Lifescience Market 96 Tests
EUR 824.00

LILRB2 ELISA KIT|Human

EF006426 Lifescience Market 96 Tests
EUR 689.00

Human LILRB2 shRNA Plasmid

20-abx956969 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

LILRB2 Antibody, HRP conjugated

1-CSB-PA013000LB01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated

1-CSB-PA013000LC01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated

1-CSB-PA013000LD01HU Cusabio
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LILRB2 Recombinant Protein (Human)

RP017797 ABM 100 ug Ask for price

LILRB2 ORF Vector (Human) (pORF)

ORF005933 ABM 1.0 ug DNA
EUR 95.00

Human CellExp? LILRB2, human recombinant

P1147-10 Biovision
EUR 131.00

Human CellExp? LILRB2, human recombinant

P1147-50 Biovision
EUR 403.00

LILRB2 ELISA Kit (Human) (OKEH01827)

OKEH01827 Aviva Systems Biology 96 Wells
EUR 727.00
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

4-RPB153Hu01 Cloud-Clone
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q8N423
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.4kDa
  • Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

cDNA Synthesis SuperMix

20-abx09801420ulSystems Abbexa
  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Evo? cDNA Kit

M1164-100 Biovision
EUR 294.00

Evo? cDNA Kit

M1164-25 Biovision
EUR 234.00

Novo? cDNA Kit

M1165-100 Biovision
EUR 354.00

Novo? cDNA Kit

M1165-25 Biovision
EUR 267.00

Evo? cDNA Supermix

M1168-100 Biovision
EUR 381.00

Evo? cDNA Supermix

M1168-25 Biovision
EUR 267.00

Novo? cDNA Supermix

M1169-100 Biovision
EUR 441.00

Novo? cDNA Supermix

M1169-25 Biovision
EUR 289.00

Polyclonal LILRB2 antibody - C-terminal region

APR01570G Leading Biology 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)

K1215401 ABM 3 x 1.0 ug
EUR 339.00

Recombinant Human LILRB2/CD85d/ILT4 Protein

RP00262 Abclonal 10 μg
EUR 149.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis

C1634310 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn

C1634330 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange

C1634340 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato

C1634350 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice

C1634360 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat

C1634390 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean

C1634370 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)

20-abx09801620ulSystems Abbexa
  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)

20-abx09802120ulSystems Abbexa
  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1215402 ABM 1.0 ug DNA
EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1215403 ABM 1.0 ug DNA
EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1215404 ABM 1.0 ug DNA
EUR 154.00

LILRB2 Protein Vector (Human) (pPB-C-His)

PV023729 ABM 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPB-N-His)

PV023730 ABM 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-HA)

PV023731 ABM 500 ng
EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-His)

PV023732 ABM 500 ng
EUR 329.00

LILRB2 3'UTR Luciferase Stable Cell Line

TU012462 ABM 1.0 ml
EUR 1394.00

LILRB2 3'UTR GFP Stable Cell Line

TU062462 ABM 1.0 ml
EUR 1394.00

cDNA Probe Diluent Solution

AR0063 BosterBio 5mL
EUR 106.00

Tetro cDNA Synthesis Kit

BIO-65042 Bioline 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 Bioline 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 Bioline 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Bioline Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 Bioline 250 Reactions Ask for price

cDNA from Arteriosclerosis: Aorta

C1236012Hd-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery

C1236013Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery

C1236013Hd-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein

C1236020Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon

C1236090Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart

C1236122Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart

C1236122Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney

C1236142Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney

C1236142Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver

C1236149Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung

C1236152Ld-1 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung

C1236152Ld-2 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung

C1236152Ld-3 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung

C1236152Ld-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung

C1236152Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas

C1236188Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen

C1236246Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach

C1236248Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit

G235 ABM 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis Kit

G236 ABM 100 x 20 ul reactions
EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix

G453 ABM 25 x 20 ul reactions
EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix

G454 ABM 100 x 20 ul reactions
EUR 169.00

circRNA cDNA Synthesis Kit

G627 ABM 25 rxn (20 ul/rxn)
EUR 309.00

Human eNOS cDNA probe

eNOS51-D-2 Alpha Diagnostics 2 ug
EUR 445.00

Plant Tissue cDNA: Arabidopsis

PC34-310 Alpha Diagnostics 10 rxn
EUR 415.00

Novo? Transcriptome cDNA Kit

M1167-100 Biovision
EUR 952.00

Novo? Transcriptome cDNA Kit

M1167-25 Biovision
EUR 441.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse)

4-PAB153Hu01 Cloud-Clone
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC

4-PAB153Hu01-APC Cloud-Clone
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAB153Hu01-Biotin Cloud-Clone
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Biotin.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Cy3

4-PAB153Hu01-Cy3 Cloud-Clone
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Cy3.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), FITC

4-PAB153Hu01-FITC Cloud-Clone
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with FITC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), HRP

4-PAB153Hu01-HRP Cloud-Clone
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with HRP.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), PE

4-PAB153Hu01-PE Cloud-Clone
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with PE.

Human LILRB2 Protein (Gln 22-Val 461) [Fc]

VAng-1888Lsx-100g Creative Biolabs 100 µg
EUR 765.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [Fc]

VAng-1888Lsx-1mg Creative Biolabs 1 mg
EUR 4174.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]

VAng-1889Lsx-100g Creative Biolabs 100 µg
EUR 765.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]

VAng-1889Lsx-1mg Creative Biolabs 1 mg
EUR 4449.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

cDNA from Alzheimer's Disease: Brain

C1236035Alz Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain

C1236035Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain

C1236035Par Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus

C1236052Dem Biochain 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus

C1236052Dep Biochain 40 reactions
EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon

C1236090Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus

C1236106Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart

C1236122Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum

C1236130Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney

C1236142Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver

C1236149Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung

C1236152Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung

C1236152Ld-5 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm

C1236169Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas

C1236188Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin

C1236218Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine

C1236226Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord

C1236234Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen

C1236246Lcs Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA

HT05-090 Alpha Diagnostics 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Lung

HA-152 Alpha Diagnostics 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Skin

HA-218 Alpha Diagnostics 10 rxn
EUR 415.00

Human Adult cDNA Tissue: Testis

HA-260 Alpha Diagnostics 10 rxn
EUR 415.00

Total-Transcriptome cDNA Synthesis Kit

G904 ABM 25 reactions
EUR 224.00

Total-Transcriptome cDNA Synthesis Kit

G905 ABM 100 reactions
EUR 544.00

Mouse iNOS (macrophage) cDNA probe

iNOS61-D-2 Alpha Diagnostics 2 ug
EUR 445.00

cDNA Synthesis SuperMix for qPCR

20-abx09801920ulSystems Abbexa
  • EUR 690.00
  • EUR 565.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Monkey (Rhesus) cDNA Tissue: Thyroid

MR34-265 Alpha Diagnostics 10 rxn
EUR 415.00

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 BenchMark 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 BenchMark 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 BenchMark 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S BenchMark 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Evo? cDNA Kit (gDNA Removal)

M1166-100 Biovision
EUR 381.00

amfiRivert cDNA Synthesis Master Mix

R5101-050 GenDepot 50 rxns
EUR 415.00

amfiRivert cDNA Synthesis Master Mix

R5101-100 GenDepot 2X50 rxns
EUR 847.00

amfiRivert cDNA Synthesis Master Mix

R5101-200 GenDepot 4X50 rxns
EUR 1211.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 GenDepot 500ul
EUR 134.00

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 GenDepot 2x500ul
EUR 192.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAB153Hu01-APC-Cy7 Cloud-Clone
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: LILRB2 (Leu53~Val255)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC-Cy7.

Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodondactylon) utilizing a normalised cDNA library

 

A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodondactylon L. A complete of 15 588 high-high quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to provide a unigene set.

 

A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient. A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly obtainable instruments, reminiscent of BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.

 

Though the candidate EST-SSRs and CISPs discovered within the current examine should be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, data of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which are thought to confer vital features in different crops.

 

Lengthy-read cDNA Sequencing Allows a ‘Gene-Like’ Transcript Annotation of Transposable Parts

 

  • Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to tell apart between doubtlessly useful expressed parts and degraded copies.

 

  • To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to establish the set of TEs capable of generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we have now layered upon the present high-quality neighborhood normal annotation.

 

  • We used this annotation to cut back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome reminiscent of maize. Our TE annotation additionally allows the testing of particular standing hypotheses within the TE discipline.

 

  • We display that incorrect TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work supplies a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to cut back the bioinformatic complexity related to repetitive TEs in any organism.

Evaluation of a real-time PCR assay for diagnosis of schistosomiasis japonica in the domestic goat

 

Background: Schistosomiasis japonica is an infectious disease caused by Schistosoma japonicum that seriously endangers human health. Domestic animals have important roles in disease transmission and goats are considered a primary reservoir host and source of infection.
The prevalence and intensity of schistosomiasis infections have significantly decreased in China, and a more sensitive, specific detection method is urgently needed. The aim of this study was to develop a real-time PCR assay for accurate detection of S. japonicum infection in goats.
Methods: A real-time PCR method for detecting schistosomiasis japonica in goats was developed by amplification of a specific S. japonicum DNA fragment, and validated using a total of 94 negative and 159 positive plasma and serum samples collected in our previous study of S. japonicum infection.
Both plasma and serum samples were evaluated by real-time PCR and enzyme-linked immunosorbent assay (ELISA). In addition, 120 goat plasma samples from an S. japonicum-endemic area (Wangjiang) and 33 from a non-endemic region (Weihai) were collected and evaluated using our method.
Results: The sensitivity and specificity of the real-time PCR for detecting infected samples were 98.74% (157/159, 95% CI: 95.53-99.85%) and 100% (94/94, 95% CI: 96.15-100%), respectively. For the ELISA, sensitivity and specificity were 98.11% (156/159, 95% CI: 94.59-99.61%) and 90.43% (85/94, 95% CI: 82.60-95.53%), respectively. Further, we found positivity rates for S. japonicum infection in Wangjiang and Weihai of 8.33% (10/120, 95% CI: 4.07-14.79%) and 0% (0/33, 95% CI: 0-10.58%), respectively.
Conclusions: The results of this study indicate that our real-time PCR method exhibits higher sensitivity and specificity than ELISA and is a useful method for detection of S. japonicum infection in goats.

Use of the PCR in a Combined Methodological Approach for the Study of Human Fascioliasis in an Endemic Area

 

Purpose: Fascioliasis is a worldwide distributed trematodiasis considered a neglected disease. Diagnosis in humans has been traditionally based on parasitological and immunological techniques.
Recently we reported the use of the PCR in stool samples for the individual diagnosis. The purpose of this study was to evaluate human fascioliasis by a combination of diagnostic methods in an area where the disease is highly endemic in animals.
Methods: We studied all the inhabitants (N = 240) of Tatón village, Argentina, by Fasciola hepatica rproCL1-ELISA. Among them, we continued the study with 13 cases that had at least two positive serological tests, who performed a questionnaire, physical examination, abdominal ultrasonography, and collection of blood and faeces. Blood/serum samples were used for Fh rproCL1-ELISA and liver function tests. Faeces were used for parasitological analysis and PCR of a repetitive fragment of Fasciola sp.
Results: Among the 13 patients, 9 presented symptoms of biliary colic. All patients repeated positive serology. F. hepatica eggs were not detected. PCR was positive in 11 cases.
Conclusion: This is the first report employing an approach based on the combination of methods for the evaluation of human fascioliasis in an endemic area, which includes molecular tools with a high value in detecting low infections.
GTPBP8 siRNA
20-abx918914 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GTPBP8 siRNA
20-abx918915 Abbexa
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GTPBP8 Rabbit pAb
A16189-100ul Abclonal 100 ul
EUR 308.00
GTPBP8 Rabbit pAb
A16189-200ul Abclonal 200 ul
EUR 459.00
GTPBP8 Rabbit pAb
A16189-20ul Abclonal 20 ul
EUR 183.00
GTPBP8 Rabbit pAb
A16189-50ul Abclonal 50 ul
EUR 223.00
GTPBP8 Polyclonal Antibody
29768-100ul SAB 100ul
EUR 252.00
GTPBP8 Polyclonal Antibody
29768-50ul SAB 50ul
EUR 187.00
GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug Cusabio 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug Cusabio 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 855
  • Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
  • Show more
Description: A cloning plasmid for the GTPBP8 gene.
Anti-GTPBP8 antibody
STJ118642 St John's Laboratory 100 µl
EUR 277.00
GTPBP8 Polyclonal Conjugated Antibody
C29768 SAB 100ul
EUR 397.00
Mouse GTPBP8 shRNA Plasmid
20-abx975375 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat GTPBP8 shRNA Plasmid
20-abx990090 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human GTPBP8 shRNA Plasmid
20-abx959177 Abbexa
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
GTPBP8 Recombinant Protein (Human)
RP014239 ABM 100 ug Ask for price
GTPBP8 Recombinant Protein (Human)
RP014242 ABM 100 ug Ask for price
GTPBP8 Recombinant Protein (Rat)
RP203999 ABM 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140480 ABM 100 ug Ask for price
GTPBP8 Recombinant Protein (Mouse)
RP140483 ABM 100 ug Ask for price
GTPBP8 ORF Vector (Human) (pORF)
ORF004747 ABM 1.0 ug DNA
EUR 95.00
GTPBP8 ORF Vector (Human) (pORF)
ORF004748 ABM 1.0 ug DNA
EUR 95.00
Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001 ABM 1.0 ug DNA
EUR 506.00
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828 ABM 1.0 ug DNA
EUR 506.00
Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829 ABM 1.0 ug DNA
EUR 506.00
cDNA Synthesis SuperMix
20-abx09801420ulSystems Abbexa
  • EUR 565.00
  • EUR 481.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Evo? cDNA Kit
M1164-100 Biovision
EUR 294.00
Evo? cDNA Kit
M1164-25 Biovision
EUR 234.00
Novo? cDNA Kit
M1165-100 Biovision
EUR 354.00
Novo? cDNA Kit
M1165-25 Biovision
EUR 267.00
Evo? cDNA Supermix
M1168-100 Biovision
EUR 381.00
Evo? cDNA Supermix
M1168-25 Biovision
EUR 267.00
Novo? cDNA Supermix
M1169-100 Biovision
EUR 441.00
Novo? cDNA Supermix
M1169-25 Biovision
EUR 289.00
GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501 ABM 3 x 1.0 ug
EUR 339.00
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501 ABM 3 x 1.0 ug
EUR 339.00
Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901 ABM 3 x 1.0 ug
EUR 339.00
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370 Biochain 40 reactions
EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems Abbexa
  • EUR 620.00
  • EUR 523.00
  • 0
  • 1
  • Shipped within 5-10 working days.
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems Abbexa
  • EUR 871.00
  • EUR 662.00
  • 0
  • 1
  • Shipped within 5-10 working days.
cDNA Probe Diluent Solution
AR0063 BosterBio 5mL
EUR 106.00
Tetro cDNA Synthesis Kit
BIO-65042 Bioline 30 Reactions Ask for price
Tetro cDNA Synthesis Kit
BIO-65043 Bioline 100 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053 Bioline 50 Reactions Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65053/S Bioline Sample Ask for price
SensiFAST cDNA Synthesis Kit
BIO-65054 Bioline 250 Reactions Ask for price
cDNA from Arteriosclerosis: Aorta
C1236012Hd-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Artery
C1236013Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Arteriosclerosis: Artery
C1236013Hd-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Vein
C1236020Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Colon
C1236090Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Heart
C1236122Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Heart
C1236122Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from hypertension: Kidney
C1236142Hd-2 Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Kidney
C1236142Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Liver
C1236149Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Asthma: Lung
C1236152Ld-1 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Bronchitis: Lung
C1236152Ld-2 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Emphysema: Lung
C1236152Ld-3 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Pneumonia: Lung
C1236152Ld-4 Biochain 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Lung
C1236152Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Pancreas
C1236188Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: Spleen
C1236246Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
cDNA from Lupus: stomach
C1236248Lup Biochain 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.
OneScriptPlus cDNA Synthesis Kit
G235 ABM 25 x 20 ul reactions
EUR 97.00
OneScriptPlus cDNA Synthesis Kit
G236 ABM 100 x 20 ul reactions
EUR 169.00
OneScriptPlus cDNA Synthesis SuperMix
G453 ABM 25 x 20 ul reactions
EUR 97.00
OneScriptPlus cDNA Synthesis SuperMix
G454 ABM 100 x 20 ul reactions
EUR 169.00
circRNA cDNA Synthesis Kit
G627 ABM 25 rxn (20 ul/rxn)
EUR 309.00
Human eNOS cDNA probe
eNOS51-D-2 Alpha Diagnostics 2 ug
EUR 445.00
Plant Tissue cDNA: Arabidopsis
PC34-310 Alpha Diagnostics 10 rxn
EUR 415.00
Novo? Transcriptome cDNA Kit
M1167-100 Biovision
EUR 952.00
Novo? Transcriptome cDNA Kit
M1167-25 Biovision
EUR 441.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502 ABM 1.0 ug DNA
EUR 154.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503 ABM 1.0 ug DNA
EUR 154.00
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903 ABM 1.0 ug DNA
EUR 154.00
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904 ABM 1.0 ug DNA
EUR 154.00
GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002 ABM 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003 ABM 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004 ABM 500 ng
EUR 603.00
GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005 ABM 500 ng
EUR 603.00
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018985 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018986 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018987 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018988 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018989 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018990 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018991 ABM 500 ng
EUR 329.00
GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018992 ABM 500 ng
EUR 329.00
Tags: dna ancestry, dna bts, dna definition, dna extraction, dna gacha life, dna h&r block, dna hrblock login, dna lyrics, dna molecule, dna nucleotide, dna painter, dna polymerase, dna productions, dna replication, dna strand, dna structure, dna synthesis, dna testing, dna testing kits, dna.hrblock.com, dnajlion7 youtube, dnalion7 youtube

Post navigation

← Dissecting effectivity of a 5′ fast amplification of cDNA ends

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Recent Posts

  • Extraction of high-quality tissue-specific RNA from London aircraft timber
  • Dissecting effectivity of a 5′ fast amplification of cDNA ends
  • Identification of mobile inhibitors in opposition to Chikungunya virus replication by a cDNA
  • In-Yeast Meeting of Coronavirus Infectious cDNA Clones
  • Identification of Avramr1 from Phytophthorainfestans utilizing lengthy learn and cDNA pathogen-enrichment

Categories

  • acute graft-versus-host disease
  • cDNA expression library
  • cytotoxic T lymphocyte antigen-4
  • genome
  • grapevine
  • hematopoietic stem cell transplantation
  • infectious cDNA clone
  • ligation-independent cloning
  • nicking enzyme
  • pathogenicity
  • piglets
  • porcine deltacoronavirus
March 2021
M T W T F S S
1234567
891011121314
15161718192021
22232425262728
293031  
« Nov    

Pages

  • Contact Us
March 2021
M T W T F S S
1234567
891011121314
15161718192021
22232425262728
293031  
« Nov    

Tags

cdna.tv cdna2 cdna amd cdna application cdna avm cdnacp cdnaf cdna for qpcr cdna library cdname cdnap cdna sbs cdna sequence cdna sequencing cdna stock cdna stock price cdna synthesis cdna synthesis pcr cdna synthesis protocol cdnaturally cdna vs genomic cdna vs genomic dna genome-wide association studies genome annotation genome bins genome biology genome browser genome browser ucsc genome definition genome editing genome genpact login genome in a sentence genome link genomeme genome medical genome of saccharomyces cerevisiae genome project genome research genome sequence genome sequencing genome sequencing machine genomes meaning genome testing protein foods protein powder
March 2021
M T W T F S S
1234567
891011121314
15161718192021
22232425262728
293031  
« Nov    
Categories
  • acute graft-versus-host disease
  • cDNA expression library
  • cytotoxic T lymphocyte antigen-4
  • genome
  • grapevine
  • hematopoietic stem cell transplantation
  • infectious cDNA clone
  • ligation-independent cloning
  • nicking enzyme
  • pathogenicity
  • piglets
  • porcine deltacoronavirus
Quick Links
  • Contact Us
Recent Posts
  • Extraction of high-quality tissue-specific RNA from London aircraft timber
  • Dissecting effectivity of a 5′ fast amplification of cDNA ends
  • Identification of mobile inhibitors in opposition to Chikungunya virus replication by a cDNA
  • In-Yeast Meeting of Coronavirus Infectious cDNA Clones
  • Identification of Avramr1 from Phytophthorainfestans utilizing lengthy learn and cDNA pathogen-enrichment
SKT Software