Extraction of high-quality tissue-specific RNA from London aircraft timber

Extraction of high-quality tissue-specific RNA from London aircraft timber (Platanusacerifolia), allowing the development of a feminine inflorescence cDNA library

 

• The London aircraft tree (PlatanusacerifoliaWilld.) has international significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

 

• An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are sure to soluble polyvinylpyrrolidone after which separated out by way of LiCl precipitation of the RNA.

 

• Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation. The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation.

 

• Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to include a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.

LILRB2 Antibody
35791-100ul	SAB	100ul	EUR 252.00

LILRB2 Antibody
DF9604	Affbiotech	200ul	EUR 304.00
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

LILRB2 Antibody
1-CSB-PA943186	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody
1-CSB-PA006212	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

LILRB2 Antibody
1-CSB-PA013000LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200

anti-LILRB2
YF-PA16864	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to LILRB2

anti-LILRB2
YF-PA16865	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to LILRB2

anti-LILRB2
YF-PA16866	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to LILRB2

LILRB2 Conjugated Antibody
C35791	SAB	100ul	EUR 397.00

LILRB2 Rabbit pAb
A10135-100ul	Abclonal	100 ul	EUR 308.00

LILRB2 Rabbit pAb
A10135-200ul	Abclonal	200 ul	EUR 459.00

LILRB2 Rabbit pAb
A10135-20ul	Abclonal	20 ul	EUR 183.00

LILRB2 Rabbit pAb
A10135-50ul	Abclonal	50 ul	EUR 223.00

LILRB2 Rabbit pAb
A12157-100ul	Abclonal	100 ul	EUR 308.00

LILRB2 Rabbit pAb
A12157-200ul	Abclonal	200 ul	EUR 459.00

LILRB2 Rabbit pAb
A12157-20ul	Abclonal	20 ul	EUR 183.00

LILRB2 Rabbit pAb
A12157-50ul	Abclonal	50 ul	EUR 223.00

LILRB2 Blocking Peptide
DF9604-BP	Affbiotech	1mg	EUR 195.00

LILRB2 cloning plasmid
CSB-CL839793HU-10ug	Cusabio	10ug	EUR 612.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1797 Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc Show more
Description: A cloning plasmid for the LILRB2 gene.

pDONR223-LILRB2 Plasmid
PVTB00316	Lifescience Market	2 ug	EUR 356.00

Anti-LILRB2 antibody
STJ112174	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody
STJ114050	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 (1D4)
YF-MA17235	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to LILRB2

LILRB2 Polyclonal Conjugated Antibody
C41960	SAB	100ul	EUR 397.00

Human LILRB2 ELISA Kit
ELA-E7745h	Lifescience Market	96 Tests	EUR 824.00

Human LILRB2 ELISA KIT
ELI-27802h	Lifescience Market	96 Tests	EUR 824.00

LILRB2 ELISA KIT|Human
EF006426	Lifescience Market	96 Tests	EUR 689.00

Human LILRB2 shRNA Plasmid
20-abx956969	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

LILRB2 Antibody, HRP conjugated
1-CSB-PA013000LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated
1-CSB-PA013000LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated
1-CSB-PA013000LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LILRB2 Recombinant Protein (Human)
RP017797	ABM	100 ug	Ask for price

LILRB2 ORF Vector (Human) (pORF)
ORF005933	ABM	1.0 ug DNA	EUR 95.00

Human CellExp? LILRB2, human recombinant
P1147-10	Biovision		EUR 131.00

Human CellExp? LILRB2, human recombinant
P1147-50	Biovision		EUR 403.00

LILRB2 ELISA Kit (Human) (OKEH01827)
OKEH01827	Aviva Systems Biology	96 Wells	EUR 727.00
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)
4-RPB153Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	0 1 2 3 4 5 6
Uniprot ID: Q8N423 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.4kDa Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	0 1
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294.00

Evo? cDNA Kit
M1164-25	Biovision		EUR 234.00

Novo? cDNA Kit
M1165-100	Biovision		EUR 354.00

Novo? cDNA Kit
M1165-25	Biovision		EUR 267.00

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381.00

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267.00

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441.00

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289.00

Polyclonal LILRB2 antibody - C-terminal region
APR01570G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)
K1215401	ABM	3 x 1.0 ug	EUR 339.00

Recombinant Human LILRB2/CD85d/ILT4 Protein
RP00262	Abclonal	10 μg	EUR 149.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	0 1
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	0 1
Shipped within 5-10 working days.

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1215402	ABM	1.0 ug DNA	EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1215403	ABM	1.0 ug DNA	EUR 154.00

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1215404	ABM	1.0 ug DNA	EUR 154.00

LILRB2 Protein Vector (Human) (pPB-C-His)
PV023729	ABM	500 ng	EUR 329.00

LILRB2 Protein Vector (Human) (pPB-N-His)
PV023730	ABM	500 ng	EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-HA)
PV023731	ABM	500 ng	EUR 329.00

LILRB2 Protein Vector (Human) (pPM-C-His)
PV023732	ABM	500 ng	EUR 329.00

LILRB2 3'UTR Luciferase Stable Cell Line
TU012462	ABM	1.0 ml	EUR 1394.00

LILRB2 3'UTR GFP Stable Cell Line
TU062462	ABM	1.0 ml	EUR 1394.00

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106.00

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169.00

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309.00

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445.00

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415.00

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952.00

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse)
4-PAB153Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC
4-PAB153Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAB153Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Biotin.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Cy3
4-PAB153Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Cy3.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), FITC
4-PAB153Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with FITC.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), HRP
4-PAB153Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with HRP.

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), PE
4-PAB153Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with PE.

Human LILRB2 Protein (Gln 22-Val 461) [Fc]
VAng-1888Lsx-100g	Creative Biolabs	100 µg	EUR 765.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [Fc]
VAng-1888Lsx-1mg	Creative Biolabs	1 mg	EUR 4174.00
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]
VAng-1889Lsx-100g	Creative Biolabs	100 µg	EUR 765.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

Human LILRB2 Protein (Gln 22-Val 461) [His]
VAng-1889Lsx-1mg	Creative Biolabs	1 mg	EUR 4449.00
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827)

cDNA from Alzheimer's Disease: Brain
C1236035Alz	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Brain
C1236035Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Parkinson's Disease: Brain
C1236035Par	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Dementia: Brain: Hippocampus
C1236052Dem	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Depression: Brain: Hippocampus
C1236052Dep	Biochain	40 reactions	EUR 801.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Colon
C1236090Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Esophagus
C1236106Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Heart
C1236122Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Interventricular Septum
C1236130Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Kidney
C1236142Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Liver
C1236149Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Lung
C1236152Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pulmonary Embolism: Lung
C1236152Ld-5	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Diaphragm
C1236169Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Pancreas
C1236188Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Skin
C1236218Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Small Intestine
C1236226Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spinal Cord
C1236234Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Liver Cirrhosis: Spleen
C1236246Lcs	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Human Tumor Tissue: Breast cDNA
HT05-090	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Lung
HA-152	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Skin
HA-218	Alpha Diagnostics	10 rxn	EUR 415.00

Human Adult cDNA Tissue: Testis
HA-260	Alpha Diagnostics	10 rxn	EUR 415.00

Total-Transcriptome cDNA Synthesis Kit
G904	ABM	25 reactions	EUR 224.00

Total-Transcriptome cDNA Synthesis Kit
G905	ABM	100 reactions	EUR 544.00

Mouse iNOS (macrophage) cDNA probe
iNOS61-D-2	Alpha Diagnostics	2 ug	EUR 445.00

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	0 1
Shipped within 5-10 working days.

Monkey (Rhesus) cDNA Tissue: Thyroid
MR34-265	Alpha Diagnostics	10 rxn	EUR 415.00

Accuris qMax cDNA Synthesis Kit
PR2100-C-100	BenchMark	1 PC	EUR 337.75
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-25	BenchMark	1 PC	EUR 142.36
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-250	BenchMark	1 PC	EUR 711.77
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-S	BenchMark	1 PC	EUR 77.76
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Evo? cDNA Kit (gDNA Removal)
M1166-100	Biovision		EUR 381.00

amfiRivert cDNA Synthesis Master Mix
R5101-050	GenDepot	50 rxns	EUR 415.00

amfiRivert cDNA Synthesis Master Mix
R5101-100	GenDepot	2X50 rxns	EUR 847.00

amfiRivert cDNA Synthesis Master Mix
R5101-200	GenDepot	4X50 rxns	EUR 1211.00

amfiRivet cDNA Synthesis 2X Buffer
R5102-050	GenDepot	500ul	EUR 134.00

amfiRivet cDNA Synthesis 2X Buffer
R5102-100	GenDepot	2x500ul	EUR 192.00

Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAB153Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	0 1 2 3 4
Sequence of the immunogen: LILRB2 (Leu53~Val255) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC-Cy7.

Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodondactylon) utilizing a normalised cDNA library

 

A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodondactylon L. A complete of 15 588 high-high quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to provide a unigene set.

 

A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient. A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly obtainable instruments, reminiscent of BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.

 

Though the candidate EST-SSRs and CISPs discovered within the current examine should be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, data of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which are thought to confer vital features in different crops.

 

Lengthy-read cDNA Sequencing Allows a ‘Gene-Like’ Transcript Annotation of Transposable Parts

 

• Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to tell apart between doubtlessly useful expressed parts and degraded copies.

 

• To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to establish the set of TEs capable of generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we have now layered upon the present high-quality neighborhood normal annotation.

 

• We used this annotation to cut back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome reminiscent of maize. Our TE annotation additionally allows the testing of particular standing hypotheses within the TE discipline.

 

• We display that incorrect TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work supplies a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to cut back the bioinformatic complexity related to repetitive TEs in any organism.

 

Use of the PCR in a Combined Methodological Approach for the Study of Human Fascioliasis in an Endemic Area

 

GTPBP8 siRNA
20-abx918914	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GTPBP8 siRNA
20-abx918915	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GTPBP8 Rabbit pAb
A16189-100ul	Abclonal	100 ul	EUR 308.00

GTPBP8 Rabbit pAb
A16189-200ul	Abclonal	200 ul	EUR 459.00

GTPBP8 Rabbit pAb
A16189-20ul	Abclonal	20 ul	EUR 183.00

GTPBP8 Rabbit pAb
A16189-50ul	Abclonal	50 ul	EUR 223.00

GTPBP8 Polyclonal Antibody
29768-100ul	SAB	100ul	EUR 252.00

GTPBP8 Polyclonal Antibody
29768-50ul	SAB	50ul	EUR 187.00

GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 513 Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc Show more
Description: A cloning plasmid for the GTPBP8 gene.

GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 855 Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc Show more
Description: A cloning plasmid for the GTPBP8 gene.

Anti-GTPBP8 antibody
STJ118642	St John's Laboratory	100 µl	EUR 277.00

GTPBP8 Polyclonal Conjugated Antibody
C29768	SAB	100ul	EUR 397.00

Mouse GTPBP8 shRNA Plasmid
20-abx975375	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GTPBP8 shRNA Plasmid
20-abx990090	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GTPBP8 shRNA Plasmid
20-abx959177	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GTPBP8 Recombinant Protein (Human)
RP014239	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Human)
RP014242	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Rat)
RP203999	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Mouse)
RP140480	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Mouse)
RP140483	ABM	100 ug	Ask for price

GTPBP8 ORF Vector (Human) (pORF)
ORF004747	ABM	1.0 ug DNA	EUR 95.00

GTPBP8 ORF Vector (Human) (pORF)
ORF004748	ABM	1.0 ug DNA	EUR 95.00

Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001	ABM	1.0 ug DNA	EUR 506.00

Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828	ABM	1.0 ug DNA	EUR 506.00

Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829	ABM	1.0 ug DNA	EUR 506.00

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	0 1
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294.00

Evo? cDNA Kit
M1164-25	Biovision		EUR 234.00

Novo? cDNA Kit
M1165-100	Biovision		EUR 354.00

Novo? cDNA Kit
M1165-25	Biovision		EUR 267.00

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381.00

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267.00

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441.00

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289.00

GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501	ABM	3 x 1.0 ug	EUR 339.00

Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501	ABM	3 x 1.0 ug	EUR 339.00

Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901	ABM	3 x 1.0 ug	EUR 339.00

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	0 1
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	0 1
Shipped within 5-10 working days.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106.00

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169.00

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97.00

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169.00

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309.00

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445.00

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415.00

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952.00

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441.00

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502	ABM	1.0 ug DNA	EUR 154.00

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503	ABM	1.0 ug DNA	EUR 154.00

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903	ABM	1.0 ug DNA	EUR 154.00

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904	ABM	1.0 ug DNA	EUR 154.00

GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002	ABM	500 ng	EUR 603.00

GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003	ABM	500 ng	EUR 603.00

GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004	ABM	500 ng	EUR 603.00

GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005	ABM	500 ng	EUR 603.00

GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018985	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018986	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018987	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018988	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPB-C-His)
PV018989	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPB-N-His)
PV018990	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPM-C-HA)
PV018991	ABM	500 ng	EUR 329.00

GTPBP8 Protein Vector (Human) (pPM-C-His)
PV018992	ABM	500 ng	EUR 329.00