Extraction of high-quality tissue-specific RNA from London aircraft timber (Platanusacerifolia), allowing the development of a feminine inflorescence cDNA library
- The London aircraft tree (PlatanusacerifoliaWilld.) has international significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.
- An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are sure to soluble polyvinylpyrrolidone after which separated out by way of LiCl precipitation of the RNA.
- Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation. The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation.
- Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to include a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.

asean-ndi
LILRB2 Antibody |
35791-100ul |
SAB |
100ul |
EUR 252.00 |
LILRB2 Antibody |
DF9604 |
Affbiotech |
200ul |
EUR 304.00 |
Description: LILRB2 Antibody detects endogenous levels of total LILRB2. |
LILRB2 Antibody |
1-CSB-PA943186 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
LILRB2 Antibody |
1-CSB-PA006212 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000 |
LILRB2 Antibody |
1-CSB-PA013000LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200 |
anti-LILRB2 |
YF-PA16864 |
Abfrontier |
50 ul |
EUR 363.00 |
Description: Mouse polyclonal to LILRB2 |
anti-LILRB2 |
YF-PA16865 |
Abfrontier |
50 ug |
EUR 363.00 |
Description: Mouse polyclonal to LILRB2 |
anti-LILRB2 |
YF-PA16866 |
Abfrontier |
100 ug |
EUR 403.00 |
Description: Rabbit polyclonal to LILRB2 |
LILRB2 Conjugated Antibody |
C35791 |
SAB |
100ul |
EUR 397.00 |
LILRB2 Rabbit pAb |
A10135-100ul |
Abclonal |
100 ul |
EUR 308.00 |
LILRB2 Rabbit pAb |
A10135-200ul |
Abclonal |
200 ul |
EUR 459.00 |
LILRB2 Rabbit pAb |
A10135-20ul |
Abclonal |
20 ul |
EUR 183.00 |
LILRB2 Rabbit pAb |
A10135-50ul |
Abclonal |
50 ul |
EUR 223.00 |
LILRB2 Rabbit pAb |
A12157-100ul |
Abclonal |
100 ul |
EUR 308.00 |
LILRB2 Rabbit pAb |
A12157-200ul |
Abclonal |
200 ul |
EUR 459.00 |
LILRB2 Rabbit pAb |
A12157-20ul |
Abclonal |
20 ul |
EUR 183.00 |
LILRB2 Rabbit pAb |
A12157-50ul |
Abclonal |
50 ul |
EUR 223.00 |
LILRB2 Blocking Peptide |
DF9604-BP |
Affbiotech |
1mg |
EUR 195.00 |
LILRB2 cloning plasmid |
CSB-CL839793HU-10ug |
Cusabio |
10ug |
EUR 612.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1797
- Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc
- Show more
|
Description: A cloning plasmid for the LILRB2 gene. |
Anti-LILRB2 antibody |
STJ112174 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-LILRB2 antibody |
STJ114050 |
St John's Laboratory |
100 µl |
EUR 277.00 |
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-LILRB2 (1D4) |
YF-MA17235 |
Abfrontier |
100 ug |
EUR 363.00 |
Description: Mouse monoclonal to LILRB2 |
LILRB2 Polyclonal Conjugated Antibody |
C41960 |
SAB |
100ul |
EUR 397.00 |
Human LILRB2 shRNA Plasmid |
20-abx956969 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LILRB2 Antibody, HRP conjugated |
1-CSB-PA013000LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LILRB2 Antibody, FITC conjugated |
1-CSB-PA013000LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LILRB2 Antibody, Biotin conjugated |
1-CSB-PA013000LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LILRB2 Recombinant Protein (Human) |
RP017797 |
ABM |
100 ug |
Ask for price |
LILRB2 ORF Vector (Human) (pORF) |
ORF005933 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Human CellExp? LILRB2, human recombinant |
P1147-10 |
Biovision |
|
EUR 131.00 |
Human CellExp? LILRB2, human recombinant |
P1147-50 |
Biovision |
|
EUR 403.00 |
LILRB2 ELISA Kit (Human) (OKEH01827) |
OKEH01827 |
Aviva Systems Biology |
96 Wells |
EUR 727.00 |
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL |
Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) |
4-RPB153Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
|
- Uniprot ID: Q8N423
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.4kDa
- Isoelectric Point: 8.7
|
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Novo? cDNA Kit |
M1165-100 |
Biovision |
|
EUR 354.00 |
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381.00 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267.00 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441.00 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289.00 |
Polyclonal LILRB2 antibody - C-terminal region |
APR01570G |
Leading Biology |
0.05mg |
EUR 528.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
LILRB2 sgRNA CRISPR Lentivector set (Human) |
K1215401 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Recombinant Human LILRB2/CD85d/ILT4 Protein |
RP00262 |
Abclonal |
10 μg |
EUR 149.00 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1215402 |
ABM |
1.0 ug DNA |
EUR 154.00 |
LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1215403 |
ABM |
1.0 ug DNA |
EUR 154.00 |
LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1215404 |
ABM |
1.0 ug DNA |
EUR 154.00 |
LILRB2 Protein Vector (Human) (pPB-C-His) |
PV023729 |
ABM |
500 ng |
EUR 329.00 |
LILRB2 Protein Vector (Human) (pPB-N-His) |
PV023730 |
ABM |
500 ng |
EUR 329.00 |
LILRB2 Protein Vector (Human) (pPM-C-HA) |
PV023731 |
ABM |
500 ng |
EUR 329.00 |
LILRB2 Protein Vector (Human) (pPM-C-His) |
PV023732 |
ABM |
500 ng |
EUR 329.00 |
LILRB2 3'UTR Luciferase Stable Cell Line |
TU012462 |
ABM |
1.0 ml |
EUR 1394.00 |
LILRB2 3'UTR GFP Stable Cell Line |
TU062462 |
ABM |
1.0 ml |
EUR 1394.00 |
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106.00 |
Tetro cDNA Synthesis Kit |
BIO-65042 |
Bioline |
30 Reactions |
Ask for price |
Tetro cDNA Synthesis Kit |
BIO-65043 |
Bioline |
100 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053 |
Bioline |
50 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053/S |
Bioline |
Sample |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65054 |
Bioline |
250 Reactions |
Ask for price |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Asthma: Lung |
C1236152Ld-1 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Bronchitis: Lung |
C1236152Ld-2 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Emphysema: Lung |
C1236152Ld-3 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pneumonia: Lung |
C1236152Ld-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Lung |
C1236152Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Pancreas |
C1236188Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Spleen |
C1236246Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: stomach |
C1236248Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
OneScriptPlus cDNA Synthesis Kit |
G235 |
ABM |
25 x 20 ul reactions |
EUR 97.00 |
OneScriptPlus cDNA Synthesis Kit |
G236 |
ABM |
100 x 20 ul reactions |
EUR 169.00 |
OneScriptPlus cDNA Synthesis SuperMix |
G453 |
ABM |
25 x 20 ul reactions |
EUR 97.00 |
OneScriptPlus cDNA Synthesis SuperMix |
G454 |
ABM |
100 x 20 ul reactions |
EUR 169.00 |
circRNA cDNA Synthesis Kit |
G627 |
ABM |
25 rxn (20 ul/rxn) |
EUR 309.00 |
Novo? Transcriptome cDNA Kit |
M1167-100 |
Biovision |
|
EUR 952.00 |
Novo? Transcriptome cDNA Kit |
M1167-25 |
Biovision |
|
EUR 441.00 |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse) |
4-PAB153Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC |
4-PAB153Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC. |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB153Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Biotin. |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB153Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with Cy3. |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB153Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with FITC. |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB153Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with HRP. |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), PE |
4-PAB153Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with PE. |
Human LILRB2 Protein (Gln 22-Val 461) [Fc] |
VAng-1888Lsx-100g |
Creative Biolabs |
100 µg |
EUR 765.00 |
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827) |
Human LILRB2 Protein (Gln 22-Val 461) [Fc] |
VAng-1888Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4174.00 |
Description: Human LILRB2 protein, Fc tag, expressed in human 293 cells. (Uniprot ID: AAH36827) |
Human LILRB2 Protein (Gln 22-Val 461) [His] |
VAng-1889Lsx-100g |
Creative Biolabs |
100 µg |
EUR 765.00 |
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827) |
Human LILRB2 Protein (Gln 22-Val 461) [His] |
VAng-1889Lsx-1mg |
Creative Biolabs |
1 mg |
EUR 4449.00 |
Description: Human LILRB2 protein, His tag, expressed in human 293 cells. (Uniprot ID: AAH36827) |
cDNA from Alzheimer's Disease: Brain |
C1236035Alz |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Brain |
C1236035Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Parkinson's Disease: Brain |
C1236035Par |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Dementia: Brain: Hippocampus |
C1236052Dem |
Biochain |
40 reactions |
EUR 801.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Depression: Brain: Hippocampus |
C1236052Dep |
Biochain |
40 reactions |
EUR 801.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Colon |
C1236090Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Esophagus |
C1236106Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Heart |
C1236122Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Interventricular Septum |
C1236130Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Kidney |
C1236142Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Liver |
C1236149Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Lung |
C1236152Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pulmonary Embolism: Lung |
C1236152Ld-5 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Diaphragm |
C1236169Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Pancreas |
C1236188Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Skin |
C1236218Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Small Intestine |
C1236226Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Spinal Cord |
C1236234Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Liver Cirrhosis: Spleen |
C1236246Lcs |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
Total-Transcriptome cDNA Synthesis Kit |
G904 |
ABM |
25 reactions |
EUR 224.00 |
Total-Transcriptome cDNA Synthesis Kit |
G905 |
ABM |
100 reactions |
EUR 544.00 |
cDNA Synthesis SuperMix for qPCR |
20-abx09801920ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Accuris qMax cDNA Synthesis Kit |
PR2100-C-100 |
BenchMark |
1 PC |
EUR 337.75 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Accuris qMax cDNA Synthesis Kit |
PR2100-C-25 |
BenchMark |
1 PC |
EUR 142.36 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Accuris qMax cDNA Synthesis Kit |
PR2100-C-250 |
BenchMark |
1 PC |
EUR 711.77 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Accuris qMax cDNA Synthesis Kit |
PR2100-C-S |
BenchMark |
1 PC |
EUR 77.76 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
Evo? cDNA Kit (gDNA Removal) |
M1166-100 |
Biovision |
|
EUR 381.00 |
amfiRivert cDNA Synthesis Master Mix |
R5101-050 |
GenDepot |
50 rxns |
EUR 415.00 |
amfiRivert cDNA Synthesis Master Mix |
R5101-100 |
GenDepot |
2X50 rxns |
EUR 847.00 |
amfiRivert cDNA Synthesis Master Mix |
R5101-200 |
GenDepot |
4X50 rxns |
EUR 1211.00 |
amfiRivet cDNA Synthesis 2X Buffer |
R5102-050 |
GenDepot |
500ul |
EUR 134.00 |
amfiRivet cDNA Synthesis 2X Buffer |
R5102-100 |
GenDepot |
2x500ul |
EUR 192.00 |
Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB153Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
|
- Sequence of the immunogen: LILRB2 (Leu53~Val255)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2). This antibody is labeled with APC-Cy7. |
Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodondactylon) utilizing a normalised cDNA library
A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodondactylon L. A complete of 15 588 high-high quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to provide a unigene set.
A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient. A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly obtainable instruments, reminiscent of BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.
Though the candidate EST-SSRs and CISPs discovered within the current examine should be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, data of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which are thought to confer vital features in different crops.
Lengthy-read cDNA Sequencing Allows a ‘Gene-Like’ Transcript Annotation of Transposable Parts
- Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to tell apart between doubtlessly useful expressed parts and degraded copies.
- To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to establish the set of TEs capable of generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we have now layered upon the present high-quality neighborhood normal annotation.
- We used this annotation to cut back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome reminiscent of maize. Our TE annotation additionally allows the testing of particular standing hypotheses within the TE discipline.
- We display that incorrect TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work supplies a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to cut back the bioinformatic complexity related to repetitive TEs in any organism.
Evaluation of a real-time PCR assay for diagnosis of schistosomiasis japonica in the domestic goat
Background: Schistosomiasis japonica is an infectious disease caused by Schistosoma japonicum that seriously endangers human health. Domestic animals have important roles in disease transmission and goats are considered a primary reservoir host and source of infection.
The prevalence and intensity of schistosomiasis infections have significantly decreased in China, and a more sensitive, specific detection method is urgently needed. The aim of this study was to develop a real-time PCR assay for accurate detection of S. japonicum infection in goats.
Methods: A real-time PCR method for detecting schistosomiasis japonica in goats was developed by amplification of a specific S. japonicum DNA fragment, and validated using a total of 94 negative and 159 positive plasma and serum samples collected in our previous study of S. japonicum infection.
Both plasma and serum samples were evaluated by real-time PCR and enzyme-linked immunosorbent assay (ELISA). In addition, 120 goat plasma samples from an S. japonicum-endemic area (Wangjiang) and 33 from a non-endemic region (Weihai) were collected and evaluated using our method.
Results: The sensitivity and specificity of the real-time PCR for detecting infected samples were 98.74% (157/159, 95% CI: 95.53-99.85%) and 100% (94/94, 95% CI: 96.15-100%), respectively. For the ELISA, sensitivity and specificity were 98.11% (156/159, 95% CI: 94.59-99.61%) and 90.43% (85/94, 95% CI: 82.60-95.53%), respectively. Further, we found positivity rates for S. japonicum infection in Wangjiang and Weihai of 8.33% (10/120, 95% CI: 4.07-14.79%) and 0% (0/33, 95% CI: 0-10.58%), respectively.
Conclusions: The results of this study indicate that our real-time PCR method exhibits higher sensitivity and specificity than ELISA and is a useful method for detection of S. japonicum infection in goats.
Use of the PCR in a Combined Methodological Approach for the Study of Human Fascioliasis in an Endemic Area
Purpose: Fascioliasis is a worldwide distributed trematodiasis considered a neglected disease. Diagnosis in humans has been traditionally based on parasitological and immunological techniques.
Recently we reported the use of the PCR in stool samples for the individual diagnosis. The purpose of this study was to evaluate human fascioliasis by a combination of diagnostic methods in an area where the disease is highly endemic in animals.
Methods: We studied all the inhabitants (N = 240) of Tatón village, Argentina, by Fasciola hepatica rproCL1-ELISA. Among them, we continued the study with 13 cases that had at least two positive serological tests, who performed a questionnaire, physical examination, abdominal ultrasonography, and collection of blood and faeces. Blood/serum samples were used for Fh rproCL1-ELISA and liver function tests. Faeces were used for parasitological analysis and PCR of a repetitive fragment of Fasciola sp.
Results: Among the 13 patients, 9 presented symptoms of biliary colic. All patients repeated positive serology. F. hepatica eggs were not detected. PCR was positive in 11 cases.
Conclusion: This is the first report employing an approach based on the combination of methods for the evaluation of human fascioliasis in an endemic area, which includes molecular tools with a high value in detecting low infections.
GTPBP8 siRNA |
20-abx918914 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GTPBP8 siRNA |
20-abx918915 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GTPBP8 Rabbit pAb |
A16189-100ul |
Abclonal |
100 ul |
EUR 308.00 |
GTPBP8 Rabbit pAb |
A16189-200ul |
Abclonal |
200 ul |
EUR 459.00 |
GTPBP8 Rabbit pAb |
A16189-20ul |
Abclonal |
20 ul |
EUR 183.00 |
GTPBP8 Rabbit pAb |
A16189-50ul |
Abclonal |
50 ul |
EUR 223.00 |
GTPBP8 Polyclonal Antibody |
29768-100ul |
SAB |
100ul |
EUR 252.00 |
GTPBP8 Polyclonal Antibody |
29768-50ul |
SAB |
50ul |
EUR 187.00 |
GTPBP8 cloning plasmid |
CSB-CL818697HU1-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 513
- Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
- Show more
|
Description: A cloning plasmid for the GTPBP8 gene. |
GTPBP8 cloning plasmid |
CSB-CL818697HU2-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 855
- Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc
- Show more
|
Description: A cloning plasmid for the GTPBP8 gene. |
GTPBP8 Polyclonal Conjugated Antibody |
C29768 |
SAB |
100ul |
EUR 397.00 |
Mouse GTPBP8 shRNA Plasmid |
20-abx975375 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat GTPBP8 shRNA Plasmid |
20-abx990090 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GTPBP8 shRNA Plasmid |
20-abx959177 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GTPBP8 Recombinant Protein (Human) |
RP014239 |
ABM |
100 ug |
Ask for price |
GTPBP8 Recombinant Protein (Human) |
RP014242 |
ABM |
100 ug |
Ask for price |
GTPBP8 Recombinant Protein (Rat) |
RP203999 |
ABM |
100 ug |
Ask for price |
GTPBP8 Recombinant Protein (Mouse) |
RP140480 |
ABM |
100 ug |
Ask for price |
GTPBP8 Recombinant Protein (Mouse) |
RP140483 |
ABM |
100 ug |
Ask for price |
GTPBP8 ORF Vector (Human) (pORF) |
ORF004747 |
ABM |
1.0 ug DNA |
EUR 95.00 |
GTPBP8 ORF Vector (Human) (pORF) |
ORF004748 |
ABM |
1.0 ug DNA |
EUR 95.00 |
Gtpbp8 ORF Vector (Rat) (pORF) |
ORF068001 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Gtpbp8 ORF Vector (Mouse) (pORF) |
ORF046828 |
ABM |
1.0 ug DNA |
EUR 506.00 |
Gtpbp8 ORF Vector (Mouse) (pORF) |
ORF046829 |
ABM |
1.0 ug DNA |
EUR 506.00 |
cDNA Synthesis SuperMix |
20-abx09801420ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Novo? cDNA Kit |
M1165-100 |
Biovision |
|
EUR 354.00 |
Evo? cDNA Supermix |
M1168-100 |
Biovision |
|
EUR 381.00 |
Evo? cDNA Supermix |
M1168-25 |
Biovision |
|
EUR 267.00 |
Novo? cDNA Supermix |
M1169-100 |
Biovision |
|
EUR 441.00 |
Novo? cDNA Supermix |
M1169-25 |
Biovision |
|
EUR 289.00 |
GTPBP8 sgRNA CRISPR Lentivector set (Human) |
K0919501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Gtpbp8 sgRNA CRISPR Lentivector set (Mouse) |
K4112501 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
Gtpbp8 sgRNA CRISPR Lentivector set (Rat) |
K7385901 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis |
C1634310 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Corn |
C1634330 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Orange |
C1634340 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Potato |
C1634350 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Rice |
C1634360 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Wheat |
C1634390 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean |
C1634370 |
Biochain |
40 reactions |
EUR 621.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb) |
20-abx09801620ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb) |
20-abx09802120ulSystems |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
cDNA Probe Diluent Solution |
AR0063 |
BosterBio |
5mL |
EUR 106.00 |
Tetro cDNA Synthesis Kit |
BIO-65042 |
Bioline |
30 Reactions |
Ask for price |
Tetro cDNA Synthesis Kit |
BIO-65043 |
Bioline |
100 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053 |
Bioline |
50 Reactions |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65053/S |
Bioline |
Sample |
Ask for price |
SensiFAST cDNA Synthesis Kit |
BIO-65054 |
Bioline |
250 Reactions |
Ask for price |
cDNA from Arteriosclerosis: Aorta |
C1236012Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Artery |
C1236013Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Arteriosclerosis: Artery |
C1236013Hd-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Vein |
C1236020Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Colon |
C1236090Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Heart |
C1236122Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Heart |
C1236122Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from hypertension: Kidney |
C1236142Hd-2 |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Kidney |
C1236142Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Liver |
C1236149Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Asthma: Lung |
C1236152Ld-1 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Bronchitis: Lung |
C1236152Ld-2 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Emphysema: Lung |
C1236152Ld-3 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Pneumonia: Lung |
C1236152Ld-4 |
Biochain |
40 reactions |
EUR 811.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Lung |
C1236152Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Pancreas |
C1236188Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: Spleen |
C1236246Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
cDNA from Lupus: stomach |
C1236248Lup |
Biochain |
40 reactions |
EUR 668.00 |
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes. |
OneScriptPlus cDNA Synthesis Kit |
G235 |
ABM |
25 x 20 ul reactions |
EUR 97.00 |
OneScriptPlus cDNA Synthesis Kit |
G236 |
ABM |
100 x 20 ul reactions |
EUR 169.00 |
OneScriptPlus cDNA Synthesis SuperMix |
G453 |
ABM |
25 x 20 ul reactions |
EUR 97.00 |
OneScriptPlus cDNA Synthesis SuperMix |
G454 |
ABM |
100 x 20 ul reactions |
EUR 169.00 |
circRNA cDNA Synthesis Kit |
G627 |
ABM |
25 rxn (20 ul/rxn) |
EUR 309.00 |
Novo? Transcriptome cDNA Kit |
M1167-100 |
Biovision |
|
EUR 952.00 |
Novo? Transcriptome cDNA Kit |
M1167-25 |
Biovision |
|
EUR 441.00 |
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0919502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0919503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0919504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4112502 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4112503 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4112504 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7385902 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7385903 |
ABM |
1.0 ug DNA |
EUR 154.00 |
Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7385904 |
ABM |
1.0 ug DNA |
EUR 154.00 |
GTPBP8 Protein Vector (Rat) (pPB-C-His) |
PV272002 |
ABM |
500 ng |
EUR 603.00 |
GTPBP8 Protein Vector (Rat) (pPB-N-His) |
PV272003 |
ABM |
500 ng |
EUR 603.00 |
GTPBP8 Protein Vector (Rat) (pPM-C-HA) |
PV272004 |
ABM |
500 ng |
EUR 603.00 |
GTPBP8 Protein Vector (Rat) (pPM-C-His) |
PV272005 |
ABM |
500 ng |
EUR 603.00 |
GTPBP8 Protein Vector (Human) (pPB-C-His) |
PV018985 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPB-N-His) |
PV018986 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPM-C-HA) |
PV018987 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPM-C-His) |
PV018988 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPB-C-His) |
PV018989 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPB-N-His) |
PV018990 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPM-C-HA) |
PV018991 |
ABM |
500 ng |
EUR 329.00 |
GTPBP8 Protein Vector (Human) (pPM-C-His) |
PV018992 |
ABM |
500 ng |
EUR 329.00 |
Tags:
dna ancestry,
dna bts,
dna definition,
dna extraction,
dna gacha life,
dna h&r block,
dna hrblock login,
dna lyrics,
dna molecule,
dna nucleotide,
dna painter,
dna polymerase,
dna productions,
dna replication,
dna strand,
dna structure,
dna synthesis,
dna testing,
dna testing kits,
dna.hrblock.com,
dnajlion7 youtube,
dnalion7 youtube