Extraction of high-quality tissue-specific RNA from London aircraft timber

Extraction of high-quality tissue-specific RNA from London aircraft timber (Platanusacerifolia), allowing the development of a feminine inflorescence cDNA library

 

• The London aircraft tree (PlatanusacerifoliaWilld.) has international significance as an city landscaping tree and is the topic of genetic-improvement applications for productive sterility, illness and/or insect resistance. Molecular evaluation methods are essential to such applications, however could also be impeded by particular difficulties encountered throughout nucleic acid isolation.

 

• An in depth RNA isolation and purification protocol, primarily based on established cetyltrimethyl-ammonium bromide (CTAB) extraction methods mixed with further purification steps utilizing butanol and the ionic detergent CTAB, which overcomes these issues within the woody species P. acerifolia, was carried out. Briefly, phenolic compounds are sure to soluble polyvinylpyrrolidone after which separated out by way of LiCl precipitation of the RNA.

 

• Subsequently, protein- and carbohydrate-contaminants are eliminated by chloroform partitioning adopted by LiCl-mediated precipitation. The ensuing isolates of RNA have been discovered to be of enough high quality for profitable use in reverse transcription PCR evaluation.

 

• Moreover, RNA isolates from feminine inflorescences have been used for the development of a cDNA library. This library was discovered to include a number of full-length cDNA clones of MADS-box genes, according to the library being consultant of inflorescence expression profiles.

LILRB2 Antibody
1-CSB-PA943186	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

LILRB2 Antibody
DF9604	Affbiotech	200ul	EUR 304
Description: LILRB2 Antibody detects endogenous levels of total LILRB2.

LILRB2 Antibody
1-CSB-PA013000LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:20-1:200

LILRB2 siRNA
20-abx922560	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LILRB2 Antibody
ABD9604	Lifescience Market	100 ug	EUR 438

anti-LILRB2
YF-PA16864	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2
YF-PA16865	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to LILRB2

anti-LILRB2
YF-PA16866	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to LILRB2

LILRB2 Rabbit pAb
A10135-100ul	Abclonal	100 ul	EUR 308

LILRB2 Rabbit pAb
A10135-200ul	Abclonal	200 ul	EUR 459

LILRB2 Rabbit pAb
A10135-20ul	Abclonal	20 ul	EUR 183

LILRB2 Rabbit pAb
A10135-50ul	Abclonal	50 ul	EUR 223

LILRB2 Rabbit pAb
A12157-100ul	Abclonal	100 ul	EUR 308

LILRB2 Rabbit pAb
A12157-200ul	Abclonal	200 ul	EUR 459

LILRB2 Rabbit pAb
A12157-20ul	Abclonal	20 ul	EUR 183

LILRB2 Rabbit pAb
A12157-50ul	Abclonal	50 ul	EUR 223

LILRB2 Blocking Peptide
DF9604-BP	Affbiotech	1mg	EUR 195

LILRB2 Conjugated Antibody
C35791	SAB	100ul	EUR 397

LILRB2 cloning plasmid
CSB-CL839793HU-10ug	Cusabio	10ug	EUR 612
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1797 Sequence: atgacccccatcgtcacagtcctgatctgtctcgggctgagtctgggccccaggacccacgtgcagacagggaccatccccaagcccaccctgtgggctgagccagactctgtgatcacccaggggagtcccgtcaccctcagttgtcaggggagccttgaagcccaggagtacc Show more
Description: A cloning plasmid for the LILRB2 gene.

pDONR223-LILRB2 Plasmid
PVTB00316	Lifescience Market	2 ug	EUR 356

Anti-LILRB2 antibody
STJ112174	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 antibody
STJ114050	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-LILRB2 (1D4)
YF-MA17235	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to LILRB2

Human LILRB2 ELISA KIT
ELI-27802h	Lifescience Market	96 Tests	EUR 824

Human LILRB2 ELISA Kit
ELA-E7745h	Lifescience Market	96 Tests	EUR 824

LILRB2 ELISA KIT|Human
EF006426	Lifescience Market	96 Tests	EUR 689

LILRB2 Polyclonal Conjugated Antibody
C41960	SAB	100ul	EUR 397

LILRB2 Antibody, HRP conjugated
1-CSB-PA013000LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LILRB2 Antibody, FITC conjugated
1-CSB-PA013000LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LILRB2 Antibody, Biotin conjugated
1-CSB-PA013000LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LILRB2. Recognizes LILRB2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human LILRB2 shRNA Plasmid
20-abx956969	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LILRB2 Recombinant Protein (Human)
RP017797	ABM	100 ug	Ask for price

Human CellExp? LILRB2, human recombinant
P1147-10	Biovision		EUR 131

Human CellExp? LILRB2, human recombinant
P1147-50	Biovision		EUR 403

LILRB2 ORF Vector (Human) (pORF)
ORF005933	ABM	1.0 ug DNA	EUR 95

LILRB2 ELISA Kit (Human) (OKEH01827)
OKEH01827	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

Recombinant Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 (LILRB2)
4-RPB153Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8N423 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.4kDa Isoelectric Point: 8.7
Description: Recombinant Human Leukocyte Immunoglobulin Like Receptor Subfamily B, Member 2 expressed in: E.coli

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

Polyclonal LILRB2 antibody - C-terminal region
APR01570G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LILRB2 - C-terminal region. This antibody is tested and proven to work in the following applications:

LILRB2 sgRNA CRISPR Lentivector set (Human)
K1215401	ABM	3 x 1.0 ug	EUR 339

Recombinant Human LILRB2/CD85d/ILT4 Protein
RP00262	Abclonal	10 μg	EUR 149

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1215402	ABM	1.0 ug DNA	EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1215403	ABM	1.0 ug DNA	EUR 154

LILRB2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1215404	ABM	1.0 ug DNA	EUR 154

LILRB2 Protein Vector (Human) (pPB-C-His)
PV023729	ABM	500 ng	EUR 329

LILRB2 Protein Vector (Human) (pPB-N-His)
PV023730	ABM	500 ng	EUR 329

LILRB2 Protein Vector (Human) (pPM-C-HA)
PV023731	ABM	500 ng	EUR 329

LILRB2 Protein Vector (Human) (pPM-C-His)
PV023732	ABM	500 ng	EUR 329

LILRB2 3'UTR GFP Stable Cell Line
TU062462	ABM	1.0 ml	EUR 1394

LILRB2 3'UTR Luciferase Stable Cell Line
TU012462	ABM	1.0 ml	EUR 1394

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Transcriptome evaluation of leaf tissue from Bermudagrass (Cynodondactylon) utilizing a normalised cDNA library

 

A normalised cDNA library was constructed from Bermudagrass to achieve perception into the transcriptome of Cynodondactylon L. A complete of 15 588 high-high quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Analysis Gene Indices clustering instruments to provide a unigene set.

 

A complete of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation process was efficient. A big-scale comparative genomic evaluation of the unigenes was carried out utilizing publicly obtainable instruments, reminiscent of BLAST, InterProScan and Gene Ontology. The unigenes have been additionally subjected to a seek for EST-derived easy sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), that are helpful as DNA markers.

 

Though the candidate EST-SSRs and CISPs discovered within the current examine should be empirically examined, they’re anticipated to be helpful as DNA markers for a lot of functions, together with comparative genomic research of grass species, by advantage of their vital similarities to EST sequences from different grasses. Thus, data of Cynodon ESTs will empower turfgrass analysis by offering homologues for genes which are thought to confer vital features in different crops.

 

Lengthy-read cDNA Sequencing Allows a ‘Gene-Like’ Transcript Annotation of Transposable Parts

 

• Transcript-based annotations of genes facilitate each genome-wide analyses and detailed single locus analysis. In distinction, transposable factor (TE) annotations are rudimentary, consisting of knowledge solely on TE location and sort. The repetitiveness and restricted annotation of TEs prevents the power to tell apart between doubtlessly useful expressed parts and degraded copies.

 

• To enhance genome-wide TE bioinformatics, we carried out long-read sequencing of cDNAs from Arabidopsis thaliana strains poor in a number of layers of TE repression. These uniquely-mapping transcripts have been used to establish the set of TEs capable of generate polyadenylated RNAs and create a brand new transcript-based annotation of TEs that we have now layered upon the present high-quality neighborhood normal annotation.

 

• We used this annotation to cut back the bioinformatic complexity related to multi-mapping reads from short-read RNA-seq experiments, and we present that this enchancment is expanded in a TE-rich genome reminiscent of maize. Our TE annotation additionally allows the testing of particular standing hypotheses within the TE discipline.

 

• We display that incorrect TE splicing doesn’t set off small RNA manufacturing, and the cell extra strongly targets DNA methylation to TEs which have the potential to make mRNAs. This work supplies a brand new transcript-based TE annotation for Arabidopsis and maize, which serves as a blueprint to cut back the bioinformatic complexity related to repetitive TEs in any organism.

 

Use of the PCR in a Combined Methodological Approach for the Study of Human Fascioliasis in an Endemic Area

 

GTPBP8 siRNA
20-abx918914	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GTPBP8 siRNA
20-abx918915	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GTPBP8 Polyclonal Antibody
29768-100ul	SAB	100ul	EUR 252

GTPBP8 Polyclonal Antibody
29768-50ul	SAB	50ul	EUR 187

GTPBP8 Rabbit pAb
A16189-100ul	Abclonal	100 ul	EUR 308

GTPBP8 Rabbit pAb
A16189-200ul	Abclonal	200 ul	EUR 459

GTPBP8 Rabbit pAb
A16189-20ul	Abclonal	20 ul	EUR 183

GTPBP8 Rabbit pAb
A16189-50ul	Abclonal	50 ul	EUR 223

GTPBP8 cloning plasmid
CSB-CL818697HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 513 Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc Show more
Description: A cloning plasmid for the GTPBP8 gene.

GTPBP8 cloning plasmid
CSB-CL818697HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 855 Sequence: atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgc Show more
Description: A cloning plasmid for the GTPBP8 gene.

Anti-GTPBP8 antibody
STJ118642	St John's Laboratory	100 µl	EUR 277

Rat GTPBP8 shRNA Plasmid
20-abx990090	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GTPBP8 shRNA Plasmid
20-abx975375	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GTPBP8 Polyclonal Conjugated Antibody
C29768	SAB	100ul	EUR 397

Human GTPBP8 shRNA Plasmid
20-abx959177	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GTPBP8 Recombinant Protein (Human)
RP014239	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Human)
RP014242	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Rat)
RP203999	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Mouse)
RP140480	ABM	100 ug	Ask for price

GTPBP8 Recombinant Protein (Mouse)
RP140483	ABM	100 ug	Ask for price

Gtpbp8 ORF Vector (Rat) (pORF)
ORF068001	ABM	1.0 ug DNA	EUR 506

GTPBP8 ORF Vector (Human) (pORF)
ORF004747	ABM	1.0 ug DNA	EUR 95

GTPBP8 ORF Vector (Human) (pORF)
ORF004748	ABM	1.0 ug DNA	EUR 95

Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046828	ABM	1.0 ug DNA	EUR 506

Gtpbp8 ORF Vector (Mouse) (pORF)
ORF046829	ABM	1.0 ug DNA	EUR 506

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Evo? cDNA Kit
M1164-100	Biovision		EUR 294

Evo? cDNA Kit
M1164-25	Biovision		EUR 234

Novo? cDNA Kit
M1165-100	Biovision		EUR 354

Novo? cDNA Kit
M1165-25	Biovision		EUR 267

Evo? cDNA Supermix
M1168-100	Biovision		EUR 381

Evo? cDNA Supermix
M1168-25	Biovision		EUR 267

Novo? cDNA Supermix
M1169-100	Biovision		EUR 441

Novo? cDNA Supermix
M1169-25	Biovision		EUR 289

Gtpbp8 sgRNA CRISPR Lentivector set (Rat)
K7385901	ABM	3 x 1.0 ug	EUR 339

Gtpbp8 sgRNA CRISPR Lentivector set (Mouse)
K4112501	ABM	3 x 1.0 ug	EUR 339

GTPBP8 sgRNA CRISPR Lentivector set (Human)
K0919501	ABM	3 x 1.0 ug	EUR 339

cDNA from Plant Normal Tissue: cDNA from Plant: Arabidopsis
C1634310	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Corn
C1634330	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Orange
C1634340	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Potato
C1634350	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Rice
C1634360	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Plant Normal Tissue: cDNA from Plant: Wheat
C1634390	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

First-Strand cDNA Synthesis SuperMix (cDNA up to 12 kb)
20-abx09801620ulSystems	Abbexa	EUR 620.00 EUR 523.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

First-Strand cDNA Synthesis SuperMix (cDNA up to 15 kb)
20-abx09802120ulSystems	Abbexa	EUR 871.00 EUR 662.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

cDNA from Plant Normal Tissue: cDNA from Plant: Soy bean
C1634370	Biochain	40 reactions	EUR 621
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA Probe Diluent Solution
AR0063	BosterBio	5mL	EUR 106

cDNA from Arteriosclerosis: Aorta
C1236012Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Artery
C1236013Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Arteriosclerosis: Artery
C1236013Hd-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Vein
C1236020Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Colon
C1236090Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Heart
C1236122Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Heart
C1236122Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from hypertension: Kidney
C1236142Hd-2	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Kidney
C1236142Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Liver
C1236149Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Asthma: Lung
C1236152Ld-1	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Bronchitis: Lung
C1236152Ld-2	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Emphysema: Lung
C1236152Ld-3	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Pneumonia: Lung
C1236152Ld-4	Biochain	40 reactions	EUR 811
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Lung
C1236152Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Pancreas
C1236188Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: Spleen
C1236246Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Lupus: stomach
C1236248Lup	Biochain	40 reactions	EUR 668
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

Human eNOS cDNA probe
eNOS51-D-2	Alpha Diagnostics	2 ug	EUR 445

Novo? Transcriptome cDNA Kit
M1167-100	Biovision		EUR 952

Novo? Transcriptome cDNA Kit
M1167-25	Biovision		EUR 441

Plant Tissue cDNA: Arabidopsis
PC34-310	Alpha Diagnostics	10 rxn	EUR 415

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7385902	ABM	1.0 ug DNA	EUR 154

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7385903	ABM	1.0 ug DNA	EUR 154

Gtpbp8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7385904	ABM	1.0 ug DNA	EUR 154

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4112502	ABM	1.0 ug DNA	EUR 154

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4112503	ABM	1.0 ug DNA	EUR 154

Gtpbp8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4112504	ABM	1.0 ug DNA	EUR 154

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0919502	ABM	1.0 ug DNA	EUR 154

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0919503	ABM	1.0 ug DNA	EUR 154

GTPBP8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0919504	ABM	1.0 ug DNA	EUR 154

GTPBP8 Protein Vector (Rat) (pPB-C-His)
PV272002	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Rat) (pPB-N-His)
PV272003	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Rat) (pPM-C-HA)
PV272004	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Rat) (pPM-C-His)
PV272005	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187310	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187311	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPM-C-HA)
PV187312	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPM-C-His)
PV187313	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPB-C-His)
PV187314	ABM	500 ng	EUR 603

GTPBP8 Protein Vector (Mouse) (pPB-N-His)
PV187315	ABM	500 ng	EUR 603